MD11G1202400.v1.1

Ribulose bisphosphate carboxylase oxygenase activase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0019789
Physical Location & Seq
Forward (+)
29375041 .. 29375571
531 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1202400.v1.1.491

Sequence Viewer

Length: 216 bp
ATGATAAACATAGGTTTTCCGAAACCTAGCATGCCGTGCAATGTCTCAAATCATAACTCATATATAATAATCACTAGTGAATTGTCCGATAACCCCCAGGCCCCATGCCGGCTCCCCGTCCCTGTGCTAAATAGCCAGAGGAAACACACTTCAGGCCCTATGCCAACACCAAACCGTCGCCCGGGACGGACCGGAATCTATCCCTACGTCCCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.86

Weight (kDa)

9.89

Isoelectric Point (pI)

66.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019789)

Species Orthologous Gene IDs
malus_domestica MD11G1202400.v1.1
pyrus_communis pycom01g11970 pycom01g12130 pycom01g12400 pycom01g12410 pycom02g18500 pycom11g01060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 135
AfiI CCNNNNNNNGG 2 cut(s) 108, 181
AhlI ACTAGT 1 cut(s) 74
AjnI CCWGG 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 49
Ama87I CYCGRG 1 cut(s) 181
AoxI GGCC 2 cut(s) 99, 154
AspS9I GGNCC 3 cut(s) 100, 155, 189
AsuC2I CCSGG 2 cut(s) 182, 183
AvaI CYCGRG 1 cut(s) 181
AvaII GGWCC 1 cut(s) 189
BceAI ACGGC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 98
BcnI CCSGG 2 cut(s) 182, 183
BcoDI GTCTC 1 cut(s) 49
BcuI ACTAGT 1 cut(s) 74
BfaI CTAG 2 cut(s) 27, 75
Bme1390I CCNGG 3 cut(s) 98, 182, 183
Bme18I GGWCC 1 cut(s) 189
BmeT110I CYCGRG 1 cut(s) 181
BmgT120I GGNCC 3 cut(s) 100, 155, 189
BmiI GGNNCC 2 cut(s) 102, 113
BmrFI CCNGG 3 cut(s) 98, 182, 183
BpuMI CCSGG 2 cut(s) 182, 183
BsaJI CCNNGG 2 cut(s) 96, 181
BsaWI WCCGGW 1 cut(s) 191
Bsc4I CCNNNNNNNGG 2 cut(s) 108, 181
Bse118I RCCGGY 1 cut(s) 108
Bse3DI GCAATG 1 cut(s) 46
BseBI CCWGG 1 cut(s) 98
BseDI CCNNGG 2 cut(s) 96, 181
BseLI CCNNNNNNNGG 2 cut(s) 108, 181
BseMI GCAATG 1 cut(s) 46
BshFI GGCC 2 cut(s) 101, 156
BsiHKCI CYCGRG 1 cut(s) 181
BsiSI CCGG 3 cut(s) 109, 182, 192
BslFI GGGAC 3 cut(s) 104, 194, 198
BslI CCNNNNNNNGG 2 cut(s) 108, 181
BsmAI GTCTC 1 cut(s) 49
BsmFI GGGAC 3 cut(s) 104, 194, 198
BsnI GGCC 2 cut(s) 101, 156
BsoBI CYCGRG 1 cut(s) 181
BspANI GGCC 2 cut(s) 101, 156
BspLI GGNNCC 2 cut(s) 102, 113
BsrDI GCAATG 1 cut(s) 46
BsrFI RCCGGY 1 cut(s) 108
BssAI RCCGGY 1 cut(s) 108
BssECI CCNNGG 2 cut(s) 96, 181
Bst2UI CCWGG 1 cut(s) 98
Bst4CI ACNGT 1 cut(s) 176
BstAPI GCANNNNNTGC 1 cut(s) 36
BstC8I GCNNGC 2 cut(s) 32, 110
BstMAI GTCTC 1 cut(s) 49
BstMWI GCNNNNNNNGC 1 cut(s) 36
BstNI CCWGG 1 cut(s) 98
BstNSI RCATGY 1 cut(s) 34
BstSCI CCNGG 3 cut(s) 96, 180, 181
BsuRI GGCC 2 cut(s) 101, 156
Cac8I GCNNGC 2 cut(s) 32, 110
Cfr10I RCCGGY 1 cut(s) 108
Cfr13I GGNCC 3 cut(s) 100, 155, 189
Cfr9I CCCGGG 1 cut(s) 181
CpoI CGGWCCG 1 cut(s) 189
CspI CGGWCCG 1 cut(s) 189
CviAII CATG 2 cut(s) 31, 105
CviJI RGCY 4 cut(s) 101, 112, 135, 156
CviKI_1 RGCY 4 cut(s) 101, 112, 135, 156
Eco47I GGWCC 1 cut(s) 189
Eco57I CTGAAG 1 cut(s) 135
Eco88I CYCGRG 1 cut(s) 181
EcoO109I RGGNCCY 2 cut(s) 100, 155
EcoRII CCWGG 1 cut(s) 96
FaeI CATG 2 cut(s) 34, 108
FaiI YATR 8 cut(s) 11, 32, 54, 61, 63, 65, 106, 161
FaqI GGGAC 3 cut(s) 104, 194, 198
FatI CATG 2 cut(s) 30, 104
FspBI CTAG 2 cut(s) 27, 75
HaeIII GGCC 2 cut(s) 101, 156
HapII CCGG 3 cut(s) 109, 182, 192
Hin1II CATG 2 cut(s) 34, 108
HinfI GANTC 1 cut(s) 195
HpaII CCGG 3 cut(s) 109, 182, 192
Hpy188I TCNGA 2 cut(s) 21, 88
Hpy99I CGWCG 1 cut(s) 180
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4IV ACGT 1 cut(s) 207
HpyCH4V TGCA 1 cut(s) 39
HpyF10VI GCNNNNNNNGC 1 cut(s) 36
HpySE526I ACGT 1 cut(s) 207
Hsp92II CATG 2 cut(s) 34, 108
KroI GCCGGC 1 cut(s) 108
KroNI GCCGGC 1 cut(s) 110
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 8 cut(s) 83, 110, 122, 135, 138, 149, 195, 205
MaeI CTAG 2 cut(s) 27, 75
MaeII ACGT 1 cut(s) 207
MluCI AATT 1 cut(s) 80
MnlI CCTC 1 cut(s) 132
MroNI GCCGGC 1 cut(s) 108
MspI CCGG 3 cut(s) 109, 182, 192
MspR9I CCNGG 3 cut(s) 98, 182, 183
MvaI CCWGG 1 cut(s) 98
MwoI GCNNNNNNNGC 1 cut(s) 36
NaeI GCCGGC 1 cut(s) 110
NciI CCSGG 2 cut(s) 182, 183
NgoMIV GCCGGC 1 cut(s) 108
NlaIII CATG 2 cut(s) 34, 108
NlaIV GGNNCC 2 cut(s) 102, 113
NspI RCATGY 1 cut(s) 34
PaeI GCATGC 1 cut(s) 34
PdiI GCCGGC 1 cut(s) 110
PfeI GAWTC 1 cut(s) 195
Psp6I CCWGG 1 cut(s) 96
PspGI CCWGG 1 cut(s) 96
PspN4I GGNNCC 2 cut(s) 102, 113
PspPI GGNCC 3 cut(s) 100, 155, 189
Rsr2I CGGWCCG 1 cut(s) 189
RsrII CGGWCCG 1 cut(s) 189
Sau96I GGNCC 3 cut(s) 100, 155, 189
ScrFI CCNGG 3 cut(s) 98, 182, 183
SetI ASST 3 cut(s) 16, 28, 210
SinI GGWCC 1 cut(s) 189
SmaI CCCGGG 1 cut(s) 183
SpeI ACTAGT 1 cut(s) 74
SphI GCATGC 1 cut(s) 34
Sse9I AATT 1 cut(s) 80
SspMI CTAG 2 cut(s) 27, 75
StyD4I CCNGG 3 cut(s) 96, 180, 181
TaaI ACNGT 1 cut(s) 176
TaiI ACGT 1 cut(s) 210
TasI AATT 1 cut(s) 80
TfiI GAWTC 1 cut(s) 195
TspGWI ACGGA 1 cut(s) 202
TspMI CCCGGG 1 cut(s) 181
VpaK11BI GGWCC 1 cut(s) 189
XceI RCATGY 1 cut(s) 34
XmaI CCCGGG 1 cut(s) 181
XspI CTAG 2 cut(s) 27, 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.