MD11G1295600.v1.1

NDH shuttles electrons from NAD(P)H plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be plastoquinone. Couples the redox reaction to proton translocation, and thus conserves the redox energy in a proton gradient

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0020251
Physical Location & Seq
Forward (+)
41350914 .. 41351127
214 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1295600.v1.1.491

Sequence Viewer

Length: 165 bp
ATGGGGGATGCTTGGTTACAATTTAGAATCCTTTTTCTTTATCCATGGGCAATGAGTTTCGATGTATTGGGAGTATACGTATTTATAGAAGCTTTAATTTTCGTGCTTGTCCTAATTGTTGGTTCAATTTATGCATGGCGAAAAGGAGCATTGGAATGGTCTTAG

Protein Analysis

55

Amino Acids

6.32

Weight (kDa)

4.78

Isoelectric Point (pI)

31.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Oxidored_q4 PF00507 9 - 53 4.3e-13 NADH-ubiquinone/plastoquinone oxidoreductase, chain 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020251)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00440
malus_domestica MD03G1163700.v1.1 MD11G1295600.v1.1
rosa_chinensis RchiOBHm_CPg0502161
rosa_roxburghii Rroxscaffold_1G00030900
rosa_wichuraiana Rw7G039190

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 75
AgsI TTSAA 1 cut(s) 126
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
BsaAI YACGTR 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 44
BsaXI ACNNNNNCTCC 2 cut(s) 63, 93
Bse3DI GCAATG 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 44
BseGI GGATG 1 cut(s) 13
BseMI GCAATG 1 cut(s) 57
Bsp19I CCATGG 1 cut(s) 44
BsrDI GCAATG 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 44
BssNAI GTATAC 1 cut(s) 76
BssT1I CCWWGG 1 cut(s) 44
Bst1107I GTATAC 1 cut(s) 76
BstBAI YACGTR 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 162
BstDSI CCRYGG 1 cut(s) 44
BstF5I GGATG 1 cut(s) 13
BstSNI TACGTA 1 cut(s) 79
BstZ17I GTATAC 1 cut(s) 76
BtgI CCRYGG 1 cut(s) 44
BtsCI GGATG 1 cut(s) 13
CviAII CATG 2 cut(s) 45, 135
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
DdeI CTNAG 1 cut(s) 162
Eco105I TACGTA 1 cut(s) 79
Eco130I CCWWGG 1 cut(s) 44
EcoT14I CCWWGG 1 cut(s) 44
EcoT22I ATGCAT 1 cut(s) 136
ErhI CCWWGG 1 cut(s) 44
FaeI CATG 2 cut(s) 48, 138
FaiI YATR 5 cut(s) 46, 76, 86, 132, 136
FatI CATG 2 cut(s) 44, 134
FblI GTMKAC 1 cut(s) 75
FokI GGATG 1 cut(s) 20
Hin1II CATG 2 cut(s) 48, 138
HindIII AAGCTT 1 cut(s) 90
HinfI GANTC 1 cut(s) 27
Hpy166II GTNNAC 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 76
HpyCH4IV ACGT 1 cut(s) 78
HpyCH4V TGCA 1 cut(s) 134
HpyF3I CTNAG 1 cut(s) 162
HpySE526I ACGT 1 cut(s) 78
Hsp92II CATG 2 cut(s) 48, 138
LmnI GCTCC 1 cut(s) 146
MaeII ACGT 1 cut(s) 78
MaeIII GTNAC 1 cut(s) 15
MluCI AATT 4 cut(s) 20, 96, 114, 126
Mph1103I ATGCAT 1 cut(s) 136
MseI TTAA 1 cut(s) 95
MslI CAYNNNNRTG 1 cut(s) 154
NcoI CCATGG 1 cut(s) 44
NlaIII CATG 2 cut(s) 48, 138
NsiI ATGCAT 1 cut(s) 136
PfeI GAWTC 1 cut(s) 27
Ppu21I YACGTR 1 cut(s) 79
RseI CAYNNNNRTG 1 cut(s) 154
SaqAI TTAA 1 cut(s) 95
SetI ASST 2 cut(s) 81, 94
SgeI CNNG 5 cut(s) 24, 57, 115, 119, 147
SmiMI CAYNNNNRTG 1 cut(s) 154
SnaBI TACGTA 1 cut(s) 79
Sse9I AATT 4 cut(s) 20, 96, 114, 126
StyI CCWWGG 1 cut(s) 44
TaiI ACGT 1 cut(s) 81
TaqI TCGA 1 cut(s) 60
TasI AATT 4 cut(s) 20, 96, 114, 126
TfiI GAWTC 1 cut(s) 27
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
XmiI GTMKAC 1 cut(s) 75
Zsp2I ATGCAT 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.