MD11G1295700.v1.1

NDH shuttles electrons from NAD(P)H plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be plastoquinone. Couples the redox reaction to proton translocation, and thus conserves the redox energy in a proton gradient

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
41351174 .. 41351563
390 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1295700.v1.1.491

Sequence Viewer

Length: 390 bp
ATGACTTCCATTATTGAATTTCCTTTACTTGATCGAACAACCCAAAATTCAGTTATTTCAACTACATCAAGTGATCTTTCAAATTGGTCAAGACTCTCCAGTTTGTGGCCGCTTCTCTATGGTACCAGTTGTTGCTTCATTGAATTTGCTTCATTAATAGGCTCACAATTCGACTTTGATCGTTATGGACTGGTACCACGATCCAATCCTAGACAGGCAGACCTAATTTTAACAGCAGGCACAGTAACAATGAAAATGGCTCCTTCTTTAGTAAGATTATATGAACAAATGCCTGAACCAAAATATATTATTGCTATGGGAGCATGCACAATTACAGGGGGATGTTCAGTACCAATTCTTATAGTACTGTTCAGGGAGTTGATAAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

14.29

Weight (kDa)

5.24

Isoelectric Point (pI)

50.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Oxidored_q6 PF01058 44 - 115 3.6e-14 NADH ubiquinone oxidoreductase, 20 Kd subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 2 cut(s) 122, 193
AccB1I GGYRCC 2 cut(s) 122, 193
AccB7I CCANNNNNTGG 1 cut(s) 105
AciI CCGC 1 cut(s) 110
AclWI GGATC 1 cut(s) 195
AcoI YGGCCR 1 cut(s) 107
AcsI RAATTY 3 cut(s) 17, 46, 143
AfaI GTAC 4 cut(s) 124, 195, 351, 366
AfiI CCNNNNNNNGG 1 cut(s) 105
AgsI TTSAA 4 cut(s) 17, 60, 81, 143
AluBI AGCT 1 cut(s) 387
AluI AGCT 1 cut(s) 387
AlwI GGATC 1 cut(s) 195
AoxI GGCC 1 cut(s) 107
ApoI RAATTY 3 cut(s) 17, 46, 143
AseI ATTAAT 1 cut(s) 155
Asp718I GGTACC 2 cut(s) 122, 193
BanI GGYRCC 2 cut(s) 122, 193
BfaI CTAG 1 cut(s) 210
BisI GCNGC 1 cut(s) 110
BlsI GCNGC 1 cut(s) 111
BmcAI AGTACT 1 cut(s) 366
BmiI GGNNCC 3 cut(s) 124, 195, 261
BpmI CTGGAG 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 105
Bse1I ACTGG 3 cut(s) 99, 126, 195
BseGI GGATG 1 cut(s) 347
BseLI CCNNNNNNNGG 1 cut(s) 105
BseNI ACTGG 3 cut(s) 99, 126, 195
BshFI GGCC 1 cut(s) 109
BshNI GGYRCC 2 cut(s) 122, 193
BslI CCNNNNNNNGG 1 cut(s) 105
BsnI GGCC 1 cut(s) 109
Bsp143I GATC 4 cut(s) 31, 73, 178, 200
BspACI CCGC 1 cut(s) 110
BspANI GGCC 1 cut(s) 109
BspLI GGNNCC 3 cut(s) 124, 195, 261
BspPI GGATC 1 cut(s) 195
BspT107I GGYRCC 2 cut(s) 122, 193
BsrI ACTGG 3 cut(s) 99, 126, 195
BssMI GATC 4 cut(s) 31, 73, 178, 200
Bst4CI ACNGT 2 cut(s) 244, 369
BstC8I GCNNGC 2 cut(s) 238, 325
BstF5I GGATG 1 cut(s) 347
BstKTI GATC 4 cut(s) 34, 76, 181, 203
BstMBI GATC 4 cut(s) 31, 73, 178, 200
BstMWI GCNNNNNNNGC 1 cut(s) 320
BstNSI RCATGY 1 cut(s) 327
BsuRI GGCC 1 cut(s) 109
BtsCI GGATG 1 cut(s) 347
Cac8I GCNNGC 2 cut(s) 238, 325
Csp6I GTAC 4 cut(s) 123, 194, 350, 365
CviAII CATG 1 cut(s) 324
CviJI RGCY 4 cut(s) 109, 162, 260, 387
CviKI_1 RGCY 4 cut(s) 109, 162, 260, 387
CviQI GTAC 4 cut(s) 123, 194, 350, 365
DpnI GATC 4 cut(s) 33, 75, 180, 202
DpnII GATC 4 cut(s) 31, 73, 178, 200
EaeI YGGCCR 1 cut(s) 107
FaeI CATG 1 cut(s) 327
FaiI YATR 8 cut(s) 120, 186, 280, 282, 306, 317, 325, 362
FatI CATG 1 cut(s) 323
Fnu4HI GCNGC 1 cut(s) 110
FokI GGATG 1 cut(s) 354
Fsp4HI GCNGC 1 cut(s) 110
FspBI CTAG 1 cut(s) 210
GluI GCNGC 1 cut(s) 110
GsuI CTGGAG 1 cut(s) 82
HaeIII GGCC 1 cut(s) 109
Hin1II CATG 1 cut(s) 327
HinfI GANTC 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 90
HpyAV CCTTC 1 cut(s) 273
HpyCH4III ACNGT 2 cut(s) 244, 369
HpyCH4V TGCA 1 cut(s) 327
HpyF10VI GCNNNNNNNGC 1 cut(s) 320
Hsp92II CATG 1 cut(s) 327
KpnI GGTACC 2 cut(s) 126, 197
Kzo9I GATC 4 cut(s) 31, 73, 178, 200
LmnI GCTCC 2 cut(s) 265, 320
LpnPI CCDG 8 cut(s) 112, 139, 176, 200, 222, 306, 321, 358
MaeI CTAG 1 cut(s) 210
MaeIII GTNAC 1 cut(s) 244
MalI GATC 4 cut(s) 33, 75, 180, 202
MboI GATC 4 cut(s) 31, 73, 178, 200
MluCI AATT 8 cut(s) 17, 46, 82, 143, 167, 225, 330, 354
MlyI GAGTC 1 cut(s) 87
MseI TTAA 2 cut(s) 155, 230
MwoI GCNNNNNNNGC 1 cut(s) 320
NdeII GATC 4 cut(s) 31, 73, 178, 200
NlaIII CATG 1 cut(s) 327
NlaIV GGNNCC 3 cut(s) 124, 195, 261
NspI RCATGY 1 cut(s) 327
PaeI GCATGC 1 cut(s) 327
PflMI CCANNNNNTGG 1 cut(s) 105
PkrI GCNGC 1 cut(s) 111
PleI GAGTC 1 cut(s) 87
PpsI GAGTC 1 cut(s) 87
PshBI ATTAAT 1 cut(s) 155
PspN4I GGNNCC 3 cut(s) 124, 195, 261
RsaI GTAC 4 cut(s) 124, 195, 351, 366
RsaNI GTAC 4 cut(s) 123, 194, 350, 365
SaqAI TTAA 2 cut(s) 155, 230
SatI GCNGC 1 cut(s) 110
Sau3AI GATC 4 cut(s) 31, 73, 178, 200
ScaI AGTACT 1 cut(s) 366
SchI GAGTC 1 cut(s) 87
SetI ASST 2 cut(s) 225, 389
SphI GCATGC 1 cut(s) 327
Sse9I AATT 8 cut(s) 17, 46, 82, 143, 167, 225, 330, 354
SsiI CCGC 1 cut(s) 110
SspMI CTAG 1 cut(s) 210
TaaI ACNGT 2 cut(s) 244, 369
TaqI TCGA 2 cut(s) 34, 171
TasI AATT 8 cut(s) 17, 46, 82, 143, 167, 225, 330, 354
TatI WGTACW 1 cut(s) 364
TauI GCSGC 1 cut(s) 112
Tru1I TTAA 2 cut(s) 155, 230
Tru9I TTAA 2 cut(s) 155, 230
TspDTI ATGAA 4 cut(s) 127, 141, 266, 297
Van91I CCANNNNNTGG 1 cut(s) 105
VspI ATTAAT 1 cut(s) 155
XapI RAATTY 3 cut(s) 17, 46, 143
XceI RCATGY 1 cut(s) 327
XspI CTAG 1 cut(s) 210
ZrmI AGTACT 1 cut(s) 366
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.