MD15G1218300.v1.1

Flavonoid 3-hydroxylase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
17577121 .. 17577447
327 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1218300.v1.1.491

Sequence Viewer

Length: 327 bp
ATGAGGTGGCGAAAAAAGAAGAATCATCATATCCCAGAGACAGCTCACGCTTTGCTTATTTGTGCATATGCTCCTAAACGCTTATGGGGTCTCCAACCCCAAAATATAAAACTTCCACCAGCTCCCAAACCATGGGCTATAATTGGCAACCTCAACCTCATTGGCCCTCTGCCTCAACAATCCCTTCACAAATTGTCCCAAACACATAGACCTATAATGAAACTTAAGTTCGGCTCGTACCCAGTTGTAATTGCCTCATCTCCAGAAATGGCAAGACAATTCTTAAGGACACATGATCACATCTTTGCTCTAGACCTGAAATGGTAG

Protein Analysis

109

Amino Acids

12.49

Weight (kDa)

10.64

Isoelectric Point (pI)

70.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 39 - 103 5.5e-09 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021147)

Species Orthologous Gene IDs
malus_domestica MD15G1218300.v1.1
rosa_chinensis RchiOBHm_Chr2g0145871
rosa_laevigata RLG00000017227
rosa_samantha Rh2BG169500 Rh2DG469600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 132
AfaI GTAC 1 cut(s) 239
AfiI CCNNNNNNNGG 1 cut(s) 132
AflII CTTAAG 2 cut(s) 224, 283
AluBI AGCT 2 cut(s) 44, 122
AluI AGCT 2 cut(s) 44, 122
Alw26I GTCTC 2 cut(s) 32, 95
AoxI GGCC 1 cut(s) 163
AspS9I GGNCC 1 cut(s) 164
BclI TGATCA 1 cut(s) 295
BcoDI GTCTC 2 cut(s) 32, 95
BfaI CTAG 1 cut(s) 311
BfrI CTTAAG 2 cut(s) 224, 283
BmgT120I GGNCC 1 cut(s) 164
BmrI ACTGGG 1 cut(s) 236
BmuI ACTGGG 1 cut(s) 236
BpmI CTGGAG 1 cut(s) 246
BsaI GGTCTC 1 cut(s) 95
BsaJI CCNNGG 1 cut(s) 131
Bsc4I CCNNNNNNNGG 1 cut(s) 132
Bse1I ACTGG 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 131
BseLI CCNNNNNNNGG 1 cut(s) 132
BseNI ACTGG 1 cut(s) 242
BshFI GGCC 1 cut(s) 165
BslFI GGGAC 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 132
BsmAI GTCTC 2 cut(s) 32, 95
BsmFI GGGAC 1 cut(s) 181
BsnI GGCC 1 cut(s) 165
Bso31I GGTCTC 1 cut(s) 95
Bsp143I GATC 1 cut(s) 295
Bsp19I CCATGG 1 cut(s) 131
BspANI GGCC 1 cut(s) 165
BspTI CTTAAG 2 cut(s) 224, 283
BspTNI GGTCTC 1 cut(s) 95
BsrI ACTGG 1 cut(s) 242
BssECI CCNNGG 1 cut(s) 131
BssMI GATC 1 cut(s) 295
BssT1I CCWWGG 1 cut(s) 131
BstAFI CTTAAG 2 cut(s) 224, 283
BstDSI CCRYGG 1 cut(s) 131
BstKTI GATC 1 cut(s) 298
BstMAI GTCTC 2 cut(s) 32, 95
BstMBI GATC 1 cut(s) 295
BsuRI GGCC 1 cut(s) 165
BtgI CCRYGG 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 164
Csp6I GTAC 1 cut(s) 238
CviAII CATG 2 cut(s) 132, 293
CviJI RGCY 5 cut(s) 44, 122, 137, 165, 234
CviKI_1 RGCY 5 cut(s) 44, 122, 137, 165, 234
CviQI GTAC 1 cut(s) 238
DpnI GATC 1 cut(s) 297
DpnII GATC 1 cut(s) 295
Eco130I CCWWGG 1 cut(s) 131
Eco31I GGTCTC 1 cut(s) 95
EcoT14I CCWWGG 1 cut(s) 131
ErhI CCWWGG 1 cut(s) 131
FaeI CATG 2 cut(s) 135, 296
FaqI GGGAC 1 cut(s) 181
FatI CATG 2 cut(s) 131, 292
FauNDI CATATG 1 cut(s) 67
FbaI TGATCA 1 cut(s) 295
FspBI CTAG 1 cut(s) 311
GsuI CTGGAG 1 cut(s) 246
HaeIII GGCC 1 cut(s) 165
Hin1II CATG 2 cut(s) 135, 296
HinfI GANTC 1 cut(s) 22
Hpy188III TCNNGA 2 cut(s) 263, 311
HpyAV CCTTC 1 cut(s) 194
HpyCH4V TGCA 1 cut(s) 65
Hsp92II CATG 2 cut(s) 135, 296
Ksp22I TGATCA 1 cut(s) 295
Kzo9I GATC 1 cut(s) 295
LmnI GCTCC 2 cut(s) 76, 127
LpnPI CCDG 4 cut(s) 48, 132, 255, 276
MaeI CTAG 1 cut(s) 311
MalI GATC 1 cut(s) 297
MboI GATC 1 cut(s) 295
MboII GAAGA 1 cut(s) 31
MluCI AATT 4 cut(s) 141, 191, 249, 278
MmeI TCCRAC 1 cut(s) 118
MnlI CCTC 5 cut(s) 161, 167, 177, 183, 265
MseI TTAA 2 cut(s) 225, 284
MspCI CTTAAG 2 cut(s) 224, 283
NcoI CCATGG 1 cut(s) 131
NdeI CATATG 1 cut(s) 67
NdeII GATC 1 cut(s) 295
NlaIII CATG 2 cut(s) 135, 296
PfeI GAWTC 1 cut(s) 22
PflMI CCANNNNNTGG 1 cut(s) 132
PspPI GGNCC 1 cut(s) 164
RsaI GTAC 1 cut(s) 239
RsaNI GTAC 1 cut(s) 238
SaqAI TTAA 2 cut(s) 225, 284
Sau3AI GATC 1 cut(s) 295
Sau96I GGNCC 1 cut(s) 164
SetI ASST 7 cut(s) 8, 46, 124, 153, 159, 214, 318
SmlI CTYRAG 2 cut(s) 224, 283
SmoI CTYRAG 2 cut(s) 224, 283
Sse9I AATT 4 cut(s) 141, 191, 249, 278
SspMI CTAG 1 cut(s) 311
StyI CCWWGG 1 cut(s) 131
TasI AATT 4 cut(s) 141, 191, 249, 278
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 2 cut(s) 225, 284
Tru9I TTAA 2 cut(s) 225, 284
TspDTI ATGAA 1 cut(s) 233
Van91I CCANNNNNTGG 1 cut(s) 132
Vha464I CTTAAG 2 cut(s) 224, 283
XbaI TCTAGA 1 cut(s) 310
XspI CTAG 1 cut(s) 311
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.