Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr15

Orthogroup ID

OG0020246

Physical Location & Seq

Genomic Coordinates Forward (+)

53874439 .. 53874643

Gene Structure 205 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD15G1438900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 198 bp

ATGGAAGAATTTCAAGGATATTTAGAACTAGATAGACATCAGCAACATGACTTCCTATACCGACTTATCCTTTGGGAGAATATTTATGCACTTGCTCATGATCATGGTTTAAATAGGTCGATTTTGTTGGATAATGTAGGTTATGACACTAAATATAGTTTACTAATCGTAAAACGTTTAATTAGTCGAATGCATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Intron_maturas2 MatK_N

Protein Analysis

66

Amino Acids

7.92

Weight (kDa)

6.15

Isoelectric Point (pI)

52.15

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
MatK_N	PF01824	1 - 64	8.8e-25	MatK/TrnK N-terminal

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020246)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG00040
malus_domestica	MD15G1438900.v1.1
pyrus_communis	pycom16g22980
rosa_chinensis	RchiOBHm_CPg0502521
rosa_samantha	Rh1AG125300 Rh1CG119200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	175
AcsI	RAATTY	1 cut(s)	8
AgsI	TTSAA	1 cut(s)	14
ApoI	RAATTY	1 cut(s)	8
ArsI	GACNNNNNNTTYG	2 cut(s)	54, 86
Asp700I	GAANNNNTTC	1 cut(s)	9
BclI	TGATCA	1 cut(s)	100
BfaI	CTAG	1 cut(s)	29
BsaBI	GATNNNNATC	1 cut(s)	36
Bse8I	GATNNNNATC	1 cut(s)	36
BseJI	GATNNNNATC	1 cut(s)	36
BsmI	GAATGC	1 cut(s)	195
Bsp143I	GATC	1 cut(s)	100
BspHI	TCATGA	1 cut(s)	97
BssMI	GATC	1 cut(s)	100
BstKTI	GATC	1 cut(s)	103
BstMBI	GATC	1 cut(s)	100
CciI	TCATGA	1 cut(s)	97
CviAII	CATG	3 cut(s)	47, 98, 104
DpnI	GATC	1 cut(s)	102
DpnII	GATC	1 cut(s)	100
DraI	TTTAAA	1 cut(s)	111
EcoT22I	ATGCAT	1 cut(s)	195
FaeI	CATG	3 cut(s)	50, 101, 107
FaiI	YATR	7 cut(s)	48, 58, 87, 99, 105, 144, 156
FatI	CATG	3 cut(s)	46, 97, 103
FbaI	TGATCA	1 cut(s)	100
FspBI	CTAG	1 cut(s)	29
FspEI	CC	9 cut(s)	58, 59, 68, 74, 83, 90, 100, 113, 123
Hin1II	CATG	3 cut(s)	50, 101, 107
Hpy166II	GTNNAC	1 cut(s)	161
Hpy188III	TCNNGA	1 cut(s)	98
Hpy8I	GTNNAC	1 cut(s)	161
HpyCH4IV	ACGT	1 cut(s)	175
HpyCH4V	TGCA	2 cut(s)	89, 193
HpySE526I	ACGT	1 cut(s)	175
Hsp92II	CATG	3 cut(s)	50, 101, 107
Ksp22I	TGATCA	1 cut(s)	100
Kzo9I	GATC	1 cut(s)	100
MaeI	CTAG	1 cut(s)	29
MaeII	ACGT	1 cut(s)	175
MalI	GATC	1 cut(s)	102
MboI	GATC	1 cut(s)	100
MboII	GAAGA	1 cut(s)	17
MluCI	AATT	2 cut(s)	8, 180
MmeI	TCCRAC	1 cut(s)	108
Mph1103I	ATGCAT	1 cut(s)	195
MroXI	GAANNNNTTC	1 cut(s)	9
MseI	TTAA	2 cut(s)	110, 179
MslI	CAYNNNNRTG	1 cut(s)	102
Mva1269I	GAATGC	1 cut(s)	195
NdeII	GATC	1 cut(s)	100
NlaIII	CATG	3 cut(s)	50, 101, 107
NsiI	ATGCAT	1 cut(s)	195
PagI	TCATGA	1 cut(s)	97
PctI	GAATGC	1 cut(s)	195
PdmI	GAANNNNTTC	1 cut(s)	9
Psp1406I	AACGTT	1 cut(s)	175
RseI	CAYNNNNRTG	1 cut(s)	102
SaqAI	TTAA	2 cut(s)	110, 179
Sau3AI	GATC	1 cut(s)	100
SetI	ASST	3 cut(s)	119, 142, 178
SgeI	CNNG	6 cut(s)	26, 41, 59, 104, 110, 116
SmiMI	CAYNNNNRTG	1 cut(s)	102
Sse9I	AATT	2 cut(s)	8, 180
SspI	AATATT	1 cut(s)	82
SspMI	CTAG	1 cut(s)	29
TaiI	ACGT	1 cut(s)	178
TaqI	TCGA	2 cut(s)	119, 187
TasI	AATT	2 cut(s)	8, 180
Tru1I	TTAA	2 cut(s)	110, 179
Tru9I	TTAA	2 cut(s)	110, 179
XapI	RAATTY	1 cut(s)	8
XmnI	GAANNNNTTC	1 cut(s)	9
XspI	CTAG	1 cut(s)	29
Zsp2I	ATGCAT	1 cut(s)	195

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.