MD16G1017300.v1.1

cytochrome b6

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0019578
Physical Location & Seq
Reverse (-)
1284235 .. 1284504
270 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1017300.v1.1.491

Sequence Viewer

Length: 270 bp
ATGACTTTTTATTATCGTCCGACCGTTACAGAGGTCTTTGCTTTTGTTCAATATGTTATGACTGAAGTTAATTTTGGTTGGTTTAATCCGATCAGTTCATCGATGGTCGGCAAGTATGATGGTCCTAATGATGATCCTGCATGTATTTTGCGTGTATCTCACCATCAACTTTTTAAAAAACCTTGTGAATTGACTTGGGTTACATGTGTGGTTTTAGGTGTATTGACCGCATATAACTGGTTATTCCTTACCTCGGGACCAAATTGGTAA

Protein Analysis

90

Amino Acids

10.28

Weight (kDa)

6.0

Isoelectric Point (pI)

25.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cytochrome_B PF00033 1 - 28 2.5e-06 Cytochrome b/b6/petB
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019578)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00730
malus_domestica MD16G1017300.v1.1
pyrus_communis pycom12397g00180
rosa_chinensis RchiOBHm_Chr3g0476911 RchiOBHm_CPg0501911 RchiOBHm_CPg0501931
rosa_wichuraiana Rw7G013570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 228
AclWI GGATC 1 cut(s) 128
AcuI CTGAAG 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 253
AflIII ACRYGT 1 cut(s) 203
AgsI TTSAA 1 cut(s) 50
AjuI GAANNNNNNNTTGG 2 cut(s) 57, 89
AlwI GGATC 1 cut(s) 128
Ama87I CYCGRG 1 cut(s) 253
AspS9I GGNCC 2 cut(s) 122, 257
AsuHPI GGTGA 1 cut(s) 152
AvaI CYCGRG 1 cut(s) 253
AvaII GGWCC 2 cut(s) 122, 257
BccI CCATC 3 cut(s) 97, 113, 171
Bme18I GGWCC 2 cut(s) 122, 257
BmeT110I CYCGRG 1 cut(s) 253
BmgT120I GGNCC 2 cut(s) 122, 257
BmiI GGNNCC 1 cut(s) 258
Bsa29I ATCGAT 1 cut(s) 101
BsaJI CCNNGG 1 cut(s) 252
Bsc4I CCNNNNNNNGG 1 cut(s) 253
Bse1I ACTGG 1 cut(s) 242
BseCI ATCGAT 1 cut(s) 101
BseDI CCNNGG 1 cut(s) 252
BseLI CCNNNNNNNGG 1 cut(s) 253
BseNI ACTGG 1 cut(s) 242
Bsh1285I CGRYCG 1 cut(s) 24
BshVI ATCGAT 1 cut(s) 101
BsiEI CGRYCG 1 cut(s) 24
BsiHKCI CYCGRG 1 cut(s) 253
BslI CCNNNNNNNGG 1 cut(s) 253
BsoBI CYCGRG 1 cut(s) 253
Bsp143I GATC 2 cut(s) 90, 133
BspACI CCGC 1 cut(s) 228
BspDI ATCGAT 1 cut(s) 101
BspLI GGNNCC 1 cut(s) 258
BspPI GGATC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 242
BssECI CCNNGG 1 cut(s) 252
BssMI GATC 2 cut(s) 90, 133
Bst4CI ACNGT 1 cut(s) 25
BstKTI GATC 2 cut(s) 93, 136
BstMBI GATC 2 cut(s) 90, 133
BstMCI CGRYCG 1 cut(s) 24
BstNSI RCATGY 2 cut(s) 144, 207
Bsu15I ATCGAT 1 cut(s) 101
BsuTUI ATCGAT 1 cut(s) 101
Cfr13I GGNCC 2 cut(s) 122, 257
ClaI ATCGAT 1 cut(s) 101
CviAII CATG 2 cut(s) 141, 204
DpnI GATC 2 cut(s) 92, 135
DpnII GATC 2 cut(s) 90, 133
DraI TTTAAA 1 cut(s) 175
Eco47I GGWCC 2 cut(s) 122, 257
Eco57I CTGAAG 1 cut(s) 84
Eco88I CYCGRG 1 cut(s) 253
FaeI CATG 2 cut(s) 144, 207
FaiI YATR 7 cut(s) 54, 59, 117, 142, 205, 232, 234
FatI CATG 2 cut(s) 140, 203
Hin1II CATG 2 cut(s) 144, 207
HphI GGTGA 1 cut(s) 152
Hpy188I TCNGA 2 cut(s) 21, 90
Hpy188III TCNNGA 1 cut(s) 255
HpyCH4III ACNGT 1 cut(s) 25
HpyCH4V TGCA 1 cut(s) 140
Hsp92II CATG 2 cut(s) 144, 207
Kzo9I GATC 2 cut(s) 90, 133
LpnPI CCDG 2 cut(s) 150, 223
MaeIII GTNAC 2 cut(s) 25, 199
MalI GATC 2 cut(s) 92, 135
MboI GATC 2 cut(s) 90, 133
MluCI AATT 3 cut(s) 70, 188, 262
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 2 cut(s) 25, 262
MseI TTAA 3 cut(s) 69, 84, 174
NdeII GATC 2 cut(s) 90, 133
NlaIII CATG 2 cut(s) 144, 207
NlaIV GGNNCC 1 cut(s) 258
NspI RCATGY 2 cut(s) 144, 207
PciI ACATGT 1 cut(s) 203
PscI ACATGT 1 cut(s) 203
PspN4I GGNNCC 1 cut(s) 258
PspPI GGNCC 2 cut(s) 122, 257
SaqAI TTAA 3 cut(s) 69, 84, 174
Sau3AI GATC 2 cut(s) 90, 133
Sau96I GGNCC 2 cut(s) 122, 257
SetI ASST 4 cut(s) 36, 184, 220, 254
SgeI CNNG 9 cut(s) 124, 149, 153, 164, 195, 207, 216, 250, 265
SinI GGWCC 2 cut(s) 122, 257
Sse9I AATT 3 cut(s) 70, 188, 262
SsiI CCGC 1 cut(s) 228
TaaI ACNGT 1 cut(s) 25
TaqI TCGA 1 cut(s) 101
TasI AATT 3 cut(s) 70, 188, 262
Tru1I TTAA 3 cut(s) 69, 84, 174
Tru9I TTAA 3 cut(s) 69, 84, 174
TspDTI ATGAA 1 cut(s) 87
VpaK11BI GGWCC 2 cut(s) 122, 257
XceI RCATGY 2 cut(s) 144, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.