MD17G1108900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
9339310 .. 9340043
734 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1108900.v1.1.491

Sequence Viewer

Length: 192 bp
ATGTGCAAACCACGTAACTCTCATTTTTGGACAAAAGCAAATCTAAGGTTTTCAATTATTTTAAAGAATGAAGTGACCGAACTACCCACACATGTTGTGCATATGCTTCCATTTAACAGAAATTTGGATGGAATGAATGAAAAATTAACAGCAGGGGCAAATCGGCGAAAAAAAATTAGCTTAAGTCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.3

Weight (kDa)

10.61

Isoelectric Point (pI)

35.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019287)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 121
AflII CTTAAG 1 cut(s) 181
AflIII ACRYGT 1 cut(s) 91
AgsI TTSAA 1 cut(s) 54
AluBI AGCT 1 cut(s) 180
AluI AGCT 1 cut(s) 180
ApoI RAATTY 1 cut(s) 121
BccI CCATC 1 cut(s) 122
BfrI CTTAAG 1 cut(s) 181
BsaAI YACGTR 1 cut(s) 14
BseGI GGATG 1 cut(s) 133
BspTI CTTAAG 1 cut(s) 181
BstAFI CTTAAG 1 cut(s) 181
BstBAI YACGTR 1 cut(s) 14
BstDEI CTNAG 1 cut(s) 44
BstF5I GGATG 1 cut(s) 133
BstNSI RCATGY 1 cut(s) 95
BtsCI GGATG 1 cut(s) 133
CspCI CAANNNNNGTGG 2 cut(s) 76, 111
CviAII CATG 1 cut(s) 92
CviJI RGCY 1 cut(s) 180
CviKI_1 RGCY 1 cut(s) 180
DdeI CTNAG 1 cut(s) 44
DraI TTTAAA 1 cut(s) 63
FaeI CATG 1 cut(s) 95
FaiI YATR 3 cut(s) 93, 102, 104
FatI CATG 1 cut(s) 91
FauNDI CATATG 1 cut(s) 102
FokI GGATG 1 cut(s) 140
Hin1II CATG 1 cut(s) 95
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 2 cut(s) 6, 100
HpyF3I CTNAG 1 cut(s) 44
HpySE526I ACGT 1 cut(s) 13
Hsp92II CATG 1 cut(s) 95
LpnPI CCDG 1 cut(s) 138
MaeII ACGT 1 cut(s) 13
MaeIII GTNAC 2 cut(s) 14, 73
MluCI AATT 4 cut(s) 54, 121, 143, 174
MseI TTAA 5 cut(s) 62, 114, 146, 182, 190
MspCI CTTAAG 1 cut(s) 181
NdeI CATATG 1 cut(s) 102
NlaIII CATG 1 cut(s) 95
NmuCI GTSAC 1 cut(s) 73
NspI RCATGY 1 cut(s) 95
PciI ACATGT 1 cut(s) 91
Ppu21I YACGTR 1 cut(s) 14
PscI ACATGT 1 cut(s) 91
SaqAI TTAA 5 cut(s) 62, 114, 146, 182, 190
SetI ASST 3 cut(s) 16, 50, 182
SgeI CNNG 3 cut(s) 24, 104, 165
SmlI CTYRAG 1 cut(s) 181
SmoI CTYRAG 1 cut(s) 181
Sse9I AATT 4 cut(s) 54, 121, 143, 174
TaiI ACGT 1 cut(s) 16
TaqII GACCGA 1 cut(s) 92
TasI AATT 4 cut(s) 54, 121, 143, 174
Tru1I TTAA 5 cut(s) 62, 114, 146, 182, 190
Tru9I TTAA 5 cut(s) 62, 114, 146, 182, 190
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
TspDTI ATGAA 3 cut(s) 84, 149, 153
Vha464I CTTAAG 1 cut(s) 181
XapI RAATTY 1 cut(s) 121
XceI RCATGY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.