pycom01g03490

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
2652335 .. 2653208
874 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g03490.5

Sequence Viewer

Length: 678 bp
ATGTTAAGTGAAAGCATGTGTGTTGCACATGATCATAGTCAGGGTGCTTTGATGTATTGGCAACAGCTGTATAGTTGGTTTTCAATTGAGTTTCTTGGATTGAATCTGATGCGAGATTTATACGCACACAAATTAAACCCTCTTTTTGACAATTGTAGTATAAGTATAAGTAGGGATCGTTCTGGACCGGGGATTAGGAGGGATTTTAAAAACGTTCACAAGGACTCAAAGGACTCAAAACAAGTTCAAAAGACTCAAAACTGCCTAAAAACACTAACTAGGCAGTTTCTGACCTTAAACCCAATGTTGGACGAATTTAAGATTATGAATGCAAAACTAAACTTTAAAACACTAAAACAAACCAAAAGACTCAAAACAACACAAACACACTCAAATCTTTGGACGAATTTGTGTAACAAAATGACTCAAAACTCTTATAAACACAAACTAAGACACTTTCTAACTAAATTAGACAATAAAGTAAAGGGGGATTTTAATTTGACGAAAATTGAAATAACGAAACAACTAGAAGGTTCTTCTCCACACATGTTACACTTGCATAATAAAATGATTTCCAATTGCATTTCAATAAACCATGAATTCTCAACACCCCAAGTTAACCGTGATGCACTAATTAACCTTCAAATCTTCCTAACGTTATTGAATTGGATGGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

226

Amino Acids

26.37

Weight (kDa)

9.71

Isoelectric Point (pI)

37.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019287)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 438
AclI AACGTT 2 cut(s) 213, 656
AclWI GGATC 1 cut(s) 183
AcsI RAATTY 3 cut(s) 314, 406, 599
AfiI CCNNNNNNNGG 1 cut(s) 307
AflIII ACRYGT 1 cut(s) 546
AgsI TTSAA 7 cut(s) 84, 103, 248, 512, 588, 644, 664
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AlwI GGATC 1 cut(s) 183
AlwNI CAGNNNCTG 1 cut(s) 289
ApoI RAATTY 3 cut(s) 314, 406, 599
AspS9I GGNCC 1 cut(s) 185
AsuC2I CCSGG 1 cut(s) 189
AvaII GGWCC 1 cut(s) 185
BccI CCATC 1 cut(s) 664
BclI TGATCA 1 cut(s) 31
BcnI CCSGG 1 cut(s) 189
BfaI CTAG 2 cut(s) 279, 527
Bme1390I CCNGG 1 cut(s) 189
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmrFI CCNGG 1 cut(s) 189
BmsI GCATC 2 cut(s) 99, 616
BpuMI CCSGG 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 188
Bsc4I CCNNNNNNNGG 1 cut(s) 307
BseDI CCNNGG 1 cut(s) 188
BseGI GGATG 1 cut(s) 675
BseLI CCNNNNNNNGG 1 cut(s) 307
BsiSI CCGG 1 cut(s) 188
BslI CCNNNNNNNGG 1 cut(s) 307
BsmI GAATGC 1 cut(s) 334
Bsp143I GATC 2 cut(s) 31, 175
BspPI GGATC 1 cut(s) 183
BssECI CCNNGG 1 cut(s) 188
BssMI GATC 2 cut(s) 31, 175
Bst4CI ACNGT 1 cut(s) 623
BstDEI CTNAG 1 cut(s) 449
BstF5I GGATG 1 cut(s) 675
BstKTI GATC 2 cut(s) 34, 178
BstMBI GATC 2 cut(s) 31, 175
BstNSI RCATGY 2 cut(s) 19, 550
BstSCI CCNGG 1 cut(s) 187
BtsCI GGATG 1 cut(s) 675
CaiI CAGNNNCTG 1 cut(s) 289
Cfr13I GGNCC 1 cut(s) 185
CviAII CATG 4 cut(s) 16, 29, 547, 596
CviJI RGCY 1 cut(s) 67
CviKI_1 RGCY 1 cut(s) 67
DdeI CTNAG 1 cut(s) 449
DpnI GATC 2 cut(s) 33, 177
DpnII GATC 2 cut(s) 31, 175
DraI TTTAAA 2 cut(s) 208, 346
Eco47I GGWCC 1 cut(s) 185
EcoRI GAATTC 1 cut(s) 599
FaeI CATG 4 cut(s) 19, 32, 550, 599
FatI CATG 4 cut(s) 15, 28, 546, 595
FbaI TGATCA 1 cut(s) 31
FspBI CTAG 2 cut(s) 279, 527
HapII CCGG 1 cut(s) 188
Hin1II CATG 4 cut(s) 19, 32, 550, 599
HincII GTYRAC 1 cut(s) 619
HindII GTYRAC 1 cut(s) 619
HinfI GANTC 6 cut(s) 103, 224, 233, 253, 369, 424
HpaI GTTAAC 1 cut(s) 619
HpaII CCGG 1 cut(s) 188
Hpy166II GTNNAC 2 cut(s) 217, 619
Hpy188I TCNGA 2 cut(s) 108, 291
Hpy188III TCNNGA 1 cut(s) 183
Hpy8I GTNNAC 2 cut(s) 217, 619
HpyAV CCTTC 2 cut(s) 524, 650
HpyCH4III ACNGT 1 cut(s) 623
HpyCH4IV ACGT 2 cut(s) 213, 656
HpyCH4V TGCA 5 cut(s) 26, 332, 559, 582, 629
HpyF3I CTNAG 1 cut(s) 449
HpySE526I ACGT 2 cut(s) 213, 656
Hsp92II CATG 4 cut(s) 19, 32, 550, 599
Ksp22I TGATCA 1 cut(s) 31
KspAI GTTAAC 1 cut(s) 619
Kzo9I GATC 2 cut(s) 31, 175
LpnPI CCDG 3 cut(s) 26, 168, 201
LweI GCATC 2 cut(s) 99, 616
MaeI CTAG 2 cut(s) 279, 527
MaeII ACGT 2 cut(s) 213, 656
MaeIII GTNAC 2 cut(s) 413, 549
MalI GATC 2 cut(s) 33, 177
MboI GATC 2 cut(s) 31, 175
MboII GAAGA 2 cut(s) 528, 640
MfeI CAATTG 3 cut(s) 84, 151, 577
MlyI GAGTC 5 cut(s) 218, 227, 247, 363, 418
MmeI TCCRAC 1 cut(s) 288
MnlI CCTC 2 cut(s) 150, 192
MseI TTAA 9 cut(s) 5, 134, 207, 296, 318, 345, 495, 618, 636
MspA1I CMGCKG 1 cut(s) 67
MspI CCGG 1 cut(s) 188
MspR9I CCNGG 1 cut(s) 189
MunI CAATTG 3 cut(s) 84, 151, 577
Mva1269I GAATGC 1 cut(s) 334
NciI CCSGG 1 cut(s) 189
NdeII GATC 2 cut(s) 31, 175
NlaIII CATG 4 cut(s) 19, 32, 550, 599
NspI RCATGY 2 cut(s) 19, 550
PciI ACATGT 1 cut(s) 546
PctI GAATGC 1 cut(s) 334
PfeI GAWTC 1 cut(s) 103
PleI GAGTC 5 cut(s) 218, 227, 247, 363, 418
PpsI GAGTC 5 cut(s) 218, 227, 247, 363, 418
PscI ACATGT 1 cut(s) 546
PsiI TTATAA 1 cut(s) 438
Psp1406I AACGTT 2 cut(s) 213, 656
PspPI GGNCC 1 cut(s) 185
PsrI GAACNNNNNNTAC 2 cut(s) 163, 195
PstNI CAGNNNCTG 1 cut(s) 289
PvuII CAGCTG 1 cut(s) 67
SaqAI TTAA 9 cut(s) 5, 134, 207, 296, 318, 345, 495, 618, 636
Sau3AI GATC 2 cut(s) 31, 175
Sau96I GGNCC 1 cut(s) 185
SchI GAGTC 5 cut(s) 218, 227, 247, 363, 418
ScrFI CCNGG 1 cut(s) 189
SetI ASST 6 cut(s) 69, 216, 296, 535, 642, 659
SfaNI GCATC 2 cut(s) 99, 616
SinI GGWCC 1 cut(s) 185
SspMI CTAG 2 cut(s) 279, 527
StyD4I CCNGG 1 cut(s) 187
TaaI ACNGT 1 cut(s) 623
TaiI ACGT 2 cut(s) 216, 659
TfiI GAWTC 1 cut(s) 103
Tru1I TTAA 9 cut(s) 5, 134, 207, 296, 318, 345, 495, 618, 636
Tru9I TTAA 9 cut(s) 5, 134, 207, 296, 318, 345, 495, 618, 636
TspDTI ATGAA 2 cut(s) 341, 612
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 3 cut(s) 314, 406, 599
XceI RCATGY 2 cut(s) 19, 550
XspI CTAG 2 cut(s) 279, 527
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.