MD17G1272000.v1.1

Anaphase-promoting complex subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0008596
Physical Location & Seq
Forward (+)
33253255 .. 33253623
369 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1272000.v1.1.491

Sequence Viewer

Length: 369 bp
ATGACTGAGGAAGCGATGAAGTGTTACAAAAGGGCAGTTAATTGTAATGACAGGGAAGCAATTGCCCTGCACCAACTAGCAAAGCTAAATTCTGAACTTGGACGTTCTGAAGAGGCAGCTTATTACTACAAGAAGGATTTGGAGAGGATGGAAGCCGAAGACAGGGAAGGACCAAATATGGTAGAAACCCTGTTATATCTTGCTCAATACTATAGGCAGCAGAAAAGATTTGAAGAATCAGAGATCTACTGTACCCGTCTTCTAGATTATACTGGCCCAGAAAAGGAAACAGCAAAGAGCTTACTTCGAGGAATGAGAATAGAACAAGCTGGTGGTCCTTCAATGGATGTTGAGCACTTTCCTCCCTAA

Protein Analysis

123

Amino Acids

14.28

Weight (kDa)

5.17

Isoelectric Point (pI)

52.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_12 PF13424 20 - 84 2.2e-06 Tetratricopeptide repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 88
AcuI CTGAAG 1 cut(s) 129
AfaI GTAC 1 cut(s) 253
AfiI CCNNNNNNNGG 2 cut(s) 162, 283
AgsI TTSAA 2 cut(s) 233, 342
AluBI AGCT 4 cut(s) 85, 119, 300, 329
AluI AGCT 4 cut(s) 85, 119, 300, 329
Alw21I GWGCWC 1 cut(s) 357
AoxI GGCC 1 cut(s) 274
ApeKI GCWGC 2 cut(s) 116, 217
ApoI RAATTY 1 cut(s) 88
AspS9I GGNCC 3 cut(s) 170, 275, 335
AvaII GGWCC 2 cut(s) 170, 335
BbsI GAAGAC 2 cut(s) 165, 251
Bbv12I GWGCWC 1 cut(s) 357
BbvI GCAGC 2 cut(s) 128, 229
BccI CCATC 1 cut(s) 142
BfaI CTAG 2 cut(s) 77, 263
BfmI CTRYAG 1 cut(s) 211
BglII AGATCT 1 cut(s) 243
BisI GCNGC 2 cut(s) 117, 218
BlsI GCNGC 2 cut(s) 118, 219
Bme18I GGWCC 2 cut(s) 170, 335
BmgT120I GGNCC 3 cut(s) 170, 275, 335
BpiI GAAGAC 2 cut(s) 165, 251
Bsc4I CCNNNNNNNGG 2 cut(s) 162, 283
Bse1I ACTGG 1 cut(s) 277
BseGI GGATG 2 cut(s) 153, 352
BseLI CCNNNNNNNGG 2 cut(s) 162, 283
BseNI ACTGG 1 cut(s) 277
BseXI GCAGC 2 cut(s) 128, 229
BsgI GTGCAG 1 cut(s) 53
BshFI GGCC 1 cut(s) 276
BsiHKAI GWGCWC 1 cut(s) 357
BslI CCNNNNNNNGG 2 cut(s) 162, 283
BsnI GGCC 1 cut(s) 276
Bsp1286I GDGCHC 1 cut(s) 357
Bsp143I GATC 1 cut(s) 243
BspANI GGCC 1 cut(s) 276
BsrI ACTGG 1 cut(s) 277
BssMI GATC 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 251
Bst6I CTCTTC 1 cut(s) 105
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 2 cut(s) 153, 352
BstKTI GATC 1 cut(s) 246
BstMBI GATC 1 cut(s) 243
BstSFI CTRYAG 1 cut(s) 211
BstV1I GCAGC 2 cut(s) 128, 229
BstV2I GAAGAC 2 cut(s) 165, 251
BstX2I RGATCY 1 cut(s) 243
BstYI RGATCY 1 cut(s) 243
BsuRI GGCC 1 cut(s) 276
BtgZI GCGATG 1 cut(s) 29
BtsCI GGATG 2 cut(s) 153, 352
Cfr13I GGNCC 3 cut(s) 170, 275, 335
Csp6I GTAC 1 cut(s) 252
CviJI RGCY 6 cut(s) 85, 119, 155, 276, 300, 329
CviKI_1 RGCY 6 cut(s) 85, 119, 155, 276, 300, 329
CviQI GTAC 1 cut(s) 252
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 245
DpnII GATC 1 cut(s) 243
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
Eco47I GGWCC 2 cut(s) 170, 335
Eco57I CTGAAG 1 cut(s) 129
FaiI YATR 4 cut(s) 179, 196, 213, 270
Fnu4HI GCNGC 2 cut(s) 117, 218
FokI GGATG 2 cut(s) 160, 359
Fsp4HI GCNGC 2 cut(s) 117, 218
FspBI CTAG 2 cut(s) 77, 263
GluI GCNGC 2 cut(s) 117, 218
HaeIII GGCC 1 cut(s) 276
HinfI GANTC 1 cut(s) 236
Hpy188I TCNGA 3 cut(s) 94, 109, 241
Hpy188III TCNNGA 1 cut(s) 263
HpyAV CCTTC 3 cut(s) 127, 161, 348
HpyCH4III ACNGT 1 cut(s) 251
HpyCH4IV ACGT 1 cut(s) 103
HpyCH4V TGCA 1 cut(s) 70
HpyF3I CTNAG 1 cut(s) 6
HpySE526I ACGT 1 cut(s) 103
Kzo9I GATC 1 cut(s) 243
LpnPI CCDG 7 cut(s) 37, 80, 148, 203, 258, 291, 315
Lsp1109I GCAGC 2 cut(s) 128, 229
MaeI CTAG 2 cut(s) 77, 263
MaeII ACGT 1 cut(s) 103
MaeIII GTNAC 1 cut(s) 23
MalI GATC 1 cut(s) 245
MboI GATC 1 cut(s) 243
MboII GAAGA 4 cut(s) 122, 170, 245, 251
MfeI CAATTG 1 cut(s) 60
MflI RGATCY 1 cut(s) 243
MhlI GDGCHC 1 cut(s) 357
MluCI AATT 3 cut(s) 40, 60, 88
MnlI CCTC 3 cut(s) 106, 138, 302
MseI TTAA 1 cut(s) 39
MunI CAATTG 1 cut(s) 60
NdeII GATC 1 cut(s) 243
PfeI GAWTC 1 cut(s) 236
PkrI GCNGC 2 cut(s) 118, 219
PspPI GGNCC 3 cut(s) 170, 275, 335
PsuI RGATCY 1 cut(s) 243
RsaI GTAC 1 cut(s) 253
RsaNI GTAC 1 cut(s) 252
SaqAI TTAA 1 cut(s) 39
SatI GCNGC 2 cut(s) 117, 218
Sau3AI GATC 1 cut(s) 243
Sau96I GGNCC 3 cut(s) 170, 275, 335
SduI GDGCHC 1 cut(s) 357
SetI ASST 5 cut(s) 87, 106, 121, 302, 331
SfcI CTRYAG 1 cut(s) 211
SinI GGWCC 2 cut(s) 170, 335
Sse9I AATT 3 cut(s) 40, 60, 88
SspMI CTAG 2 cut(s) 77, 263
TaaI ACNGT 1 cut(s) 251
TaiI ACGT 1 cut(s) 106
TaqI TCGA 1 cut(s) 307
TasI AATT 3 cut(s) 40, 60, 88
TfiI GAWTC 1 cut(s) 236
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TseI GCWGC 2 cut(s) 116, 217
TspDTI ATGAA 1 cut(s) 32
VpaK11BI GGWCC 2 cut(s) 170, 335
XapI RAATTY 1 cut(s) 88
XbaI TCTAGA 1 cut(s) 262
XspI CTAG 2 cut(s) 77, 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.