Prupe.1G303500_v2.0.a1

floral organ abscission

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
29762613 .. 29763571
959 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G303500.1

Sequence Viewer

Length: 309 bp
ATGGCTTCTTCCTCTCCCAAATCTAAACACCTTTCTTGTTCGTGCAAAACTACCATGTTTGTTGTTTCTCTCATTCTTCTTCTCATTGGGTCCTGCTCCGGTGCGAGGCTAGGGAAGACGGTGATTCTGGCGGACCATAAGGTTTTGCTGAATCTGGAGCATACGAAAACGCTCAATCCGAGAACACACCGGACAGGGTTTCAATACAGAGGCCAGGTATTCAGCTTCTTCCCCAAAGGGACCCCTATCCCTCCTTCTGGTCCTTCCAAGAGGCACAACTCAGTGGTGGATTCTACACCTCATGATTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.1

Weight (kDa)

10.13

Isoelectric Point (pI)

37.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018282)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G68765 AT3G25655
prunus_persica Prupe.1G303500_v2.0.a1
pyrus_communis pycom13g04300 pycom16g04370
rosa_chinensis RchiOBHm_Chr4g0436131
rosa_multiflora Rmu_sc0006301.1_g000002
rosa_roxburghii Rroxscaffold_5G00377230
rosa_rugosa Rorug04G0292100
rosa_wichuraiana Rw4G030260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 131
AfiI CCNNNNNNNGG 2 cut(s) 105, 257
AgsI TTSAA 1 cut(s) 203
AjnI CCWGG 1 cut(s) 213
AluBI AGCT 1 cut(s) 225
AluI AGCT 1 cut(s) 225
AoxI GGCC 1 cut(s) 211
AspS9I GGNCC 4 cut(s) 90, 133, 240, 260
AsuHPI GGTGA 1 cut(s) 133
AvaII GGWCC 4 cut(s) 90, 133, 240, 260
BbsI GAAGAC 1 cut(s) 122
BciT130I CCWGG 1 cut(s) 215
BfaI CTAG 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 215
Bme18I GGWCC 4 cut(s) 90, 133, 240, 260
BmgT120I GGNCC 4 cut(s) 90, 133, 240, 260
BmiI GGNNCC 3 cut(s) 91, 241, 242
BmrFI CCNGG 1 cut(s) 215
BpiI GAAGAC 1 cut(s) 122
BpmI CTGGAG 1 cut(s) 176
BsaWI WCCGGW 2 cut(s) 98, 189
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 257
BseBI CCWGG 1 cut(s) 215
BseLI CCNNNNNNNGG 2 cut(s) 105, 257
BseMII CTCAG 1 cut(s) 294
BshFI GGCC 1 cut(s) 213
BsiSI CCGG 2 cut(s) 99, 190
BslFI GGGAC 1 cut(s) 253
BslI CCNNNNNNNGG 2 cut(s) 105, 257
BsmFI GGGAC 1 cut(s) 253
BsnI GGCC 1 cut(s) 213
BspACI CCGC 1 cut(s) 131
BspANI GGCC 1 cut(s) 213
BspCNI CTCAG 1 cut(s) 293
BspHI TCATGA 1 cut(s) 301
BspLI GGNNCC 3 cut(s) 91, 241, 242
Bst2UI CCWGG 1 cut(s) 215
Bst4CI ACNGT 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 280
BstNI CCWGG 1 cut(s) 215
BstSCI CCNGG 1 cut(s) 213
BstV2I GAAGAC 1 cut(s) 122
BsuRI GGCC 1 cut(s) 213
BtsIMutI CAGTG 1 cut(s) 288
CciI TCATGA 1 cut(s) 301
Cfr13I GGNCC 4 cut(s) 90, 133, 240, 260
CviAII CATG 2 cut(s) 55, 302
CviJI RGCY 4 cut(s) 5, 109, 213, 225
CviKI_1 RGCY 4 cut(s) 5, 109, 213, 225
DdeI CTNAG 1 cut(s) 280
EciI GGCGGA 1 cut(s) 146
Eco47I GGWCC 4 cut(s) 90, 133, 240, 260
EcoO109I RGGNCCY 2 cut(s) 90, 240
EcoRII CCWGG 1 cut(s) 213
FaeI CATG 2 cut(s) 58, 305
FaiI YATR 4 cut(s) 56, 138, 162, 303
FaqI GGGAC 1 cut(s) 253
FatI CATG 2 cut(s) 54, 301
FspBI CTAG 1 cut(s) 110
GsuI CTGGAG 1 cut(s) 176
HaeIII GGCC 1 cut(s) 213
HapII CCGG 2 cut(s) 99, 190
Hin1II CATG 2 cut(s) 58, 305
HinfI GANTC 3 cut(s) 124, 151, 290
HpaII CCGG 2 cut(s) 99, 190
HphI GGTGA 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 180
Hpy188III TCNNGA 2 cut(s) 155, 302
HpyAV CCTTC 2 cut(s) 264, 273
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 45
HpyF3I CTNAG 1 cut(s) 280
Hsp92II CATG 2 cut(s) 58, 305
KflI GGGWCCC 1 cut(s) 240
LmnI GCTCC 2 cut(s) 101, 157
LpnPI CCDG 9 cut(s) 106, 112, 113, 140, 180, 200, 203, 227, 243
MaeI CTAG 1 cut(s) 110
MboII GAAGA 4 cut(s) 68, 71, 127, 220
MnlI CCTC 6 cut(s) 22, 99, 203, 261, 264, 309
MseI TTAA 1 cut(s) 307
MspI CCGG 2 cut(s) 99, 190
MspR9I CCNGG 1 cut(s) 215
MvaI CCWGG 1 cut(s) 215
NlaIII CATG 2 cut(s) 58, 305
NlaIV GGNNCC 3 cut(s) 91, 241, 242
PagI TCATGA 1 cut(s) 301
PcsI WCGNNNNNNNCGW 1 cut(s) 176
PfeI GAWTC 3 cut(s) 124, 151, 290
PpuMI RGGWCCY 2 cut(s) 90, 240
Psp5II RGGWCCY 2 cut(s) 90, 240
Psp6I CCWGG 1 cut(s) 213
PspGI CCWGG 1 cut(s) 213
PspN4I GGNNCC 3 cut(s) 91, 241, 242
PspPI GGNCC 4 cut(s) 90, 133, 240, 260
PspPPI RGGWCCY 2 cut(s) 90, 240
SaqAI TTAA 1 cut(s) 307
Sau96I GGNCC 4 cut(s) 90, 133, 240, 260
ScrFI CCNGG 1 cut(s) 215
SetI ASST 5 cut(s) 33, 144, 219, 227, 301
SinI GGWCC 4 cut(s) 90, 133, 240, 260
SsiI CCGC 1 cut(s) 131
SspMI CTAG 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 213
TaaI ACNGT 1 cut(s) 121
TfiI GAWTC 3 cut(s) 124, 151, 290
Tru1I TTAA 1 cut(s) 307
Tru9I TTAA 1 cut(s) 307
TscAI CASTG 1 cut(s) 288
TspRI CASTG 1 cut(s) 288
VpaK11BI GGWCC 4 cut(s) 90, 133, 240, 260
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.