Prupe.1G356200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
33027003 .. 33028677
1675 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G356200.1

Sequence Viewer

Length: 321 bp
ATGATAACGCGATCGAATCTGGCAGAGCAGTTGAGAGAGTATCAGATTCGATCGAAGCATGACTGGGCCTCCGTCTCCTTCTTCTCCTCCACCTCTAATCATACTTTATCAAGGGTGGATGTTGTGCTCTTTGTAATATGGGAACTGGTAATCCTAGCTTTCTTGGTTTTTTCAGCTGTTTCTTTATATTTTAGGCATATGCAACTTGCTTTTCTCTTACTATGCATAGCAATGCTTTTGCTTTTGTGCATAAAAATTACCAAGCAAGTGAGATTGGCGAGGAAAAAGAAACGAAGGATGCTTCTTCCCTTATCTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.46

Weight (kDa)

10.68

Isoelectric Point (pI)

35.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015937)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G20460 AT1G76185
fragaria_vesca FvH4_2g37670
malus_domestica MD08G1004300.v1.1 MD15G1003700.v1.1
prunus_persica Prupe.1G356200_v2.0.a1
pyrus_communis pycom08g00310 pycom15g00260
rosa_chinensis RchiOBHm_Chr6g0304061
rosa_laevigata RLG00000011021
rosa_roxburghii Rroxscaffold_7G00164140
rosa_rugosa Rorug06G0327400
rosa_samantha Rh6AG441200 Rh6BG461600
rosa_wichuraiana Rw6G038230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 10
AloI GAACNNNNNNTCC 2 cut(s) 135, 167
AluBI AGCT 2 cut(s) 158, 176
AluI AGCT 2 cut(s) 158, 176
Alw21I GWGCWC 1 cut(s) 129
Alw26I GTCTC 1 cut(s) 79
AoxI GGCC 1 cut(s) 66
AspS9I GGNCC 1 cut(s) 66
Bbv12I GWGCWC 1 cut(s) 129
BcoDI GTCTC 1 cut(s) 79
BfaI CTAG 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 66
BmrI ACTGGG 1 cut(s) 73
BmsI GCATC 1 cut(s) 288
BmuI ACTGGG 1 cut(s) 73
BsaXI ACNNNNNCTCC 2 cut(s) 53, 83
Bse1I ACTGG 2 cut(s) 68, 150
Bse3DI GCAATG 1 cut(s) 237
BseGI GGATG 2 cut(s) 124, 303
BseMI GCAATG 1 cut(s) 237
BseNI ACTGG 2 cut(s) 68, 150
BseRI GAGGAG 1 cut(s) 76
Bsh1236I CGCG 1 cut(s) 10
Bsh1285I CGRYCG 2 cut(s) 14, 53
BshFI GGCC 1 cut(s) 68
BsiEI CGRYCG 2 cut(s) 14, 53
BsiHKAI GWGCWC 1 cut(s) 129
BsmAI GTCTC 1 cut(s) 79
BsmBI CGTCTC 1 cut(s) 79
BsnI GGCC 1 cut(s) 68
Bsp1286I GDGCHC 1 cut(s) 129
Bsp143I GATC 2 cut(s) 11, 50
BspANI GGCC 1 cut(s) 68
BspFNI CGCG 1 cut(s) 10
BsrDI GCAATG 1 cut(s) 237
BsrI ACTGG 2 cut(s) 68, 150
BssMI GATC 2 cut(s) 11, 50
BstF5I GGATG 2 cut(s) 124, 303
BstFNI CGCG 1 cut(s) 10
BstKTI GATC 2 cut(s) 14, 53
BstMAI GTCTC 1 cut(s) 79
BstMBI GATC 2 cut(s) 11, 50
BstMCI CGRYCG 2 cut(s) 14, 53
BstUI CGCG 1 cut(s) 10
BsuRI GGCC 1 cut(s) 68
BtsCI GGATG 2 cut(s) 124, 303
Cfr13I GGNCC 1 cut(s) 66
CviAII CATG 1 cut(s) 59
CviJI RGCY 3 cut(s) 68, 158, 176
CviKI_1 RGCY 3 cut(s) 68, 158, 176
DpnI GATC 2 cut(s) 13, 52
DpnII GATC 2 cut(s) 11, 50
EcoT22I ATGCAT 1 cut(s) 227
Esp3I CGTCTC 1 cut(s) 79
FaeI CATG 1 cut(s) 62
FatI CATG 1 cut(s) 58
FauNDI CATATG 1 cut(s) 198
FokI GGATG 2 cut(s) 131, 310
FspBI CTAG 1 cut(s) 155
HaeIII GGCC 1 cut(s) 68
Hin1II CATG 1 cut(s) 62
HinfI GANTC 2 cut(s) 16, 46
Hpy188I TCNGA 1 cut(s) 45
HpyAV CCTTC 2 cut(s) 88, 288
HpyCH4V TGCA 3 cut(s) 202, 225, 249
Hsp92II CATG 1 cut(s) 62
Kzo9I GATC 2 cut(s) 11, 50
LpnPI CCDG 3 cut(s) 5, 49, 131
LweI GCATC 1 cut(s) 288
MaeI CTAG 1 cut(s) 155
MalI GATC 2 cut(s) 13, 52
MboI GATC 2 cut(s) 11, 50
MboII GAAGA 2 cut(s) 73, 296
MhlI GDGCHC 1 cut(s) 129
MluCI AATT 1 cut(s) 255
MnlI CCTC 4 cut(s) 79, 97, 103, 273
Mph1103I ATGCAT 1 cut(s) 227
MslI CAYNNNNRTG 1 cut(s) 230
MspA1I CMGCKG 1 cut(s) 176
MvnI CGCG 1 cut(s) 10
NdeI CATATG 1 cut(s) 198
NdeII GATC 2 cut(s) 11, 50
NlaIII CATG 1 cut(s) 62
NsiI ATGCAT 1 cut(s) 227
PfeI GAWTC 2 cut(s) 16, 46
Ple19I CGATCG 2 cut(s) 14, 53
PspPI GGNCC 1 cut(s) 66
PvuI CGATCG 2 cut(s) 14, 53
PvuII CAGCTG 1 cut(s) 176
RseI CAYNNNNRTG 1 cut(s) 230
Sau3AI GATC 2 cut(s) 11, 50
Sau96I GGNCC 1 cut(s) 66
SduI GDGCHC 1 cut(s) 129
SetI ASST 3 cut(s) 95, 160, 178
SfaNI GCATC 1 cut(s) 288
SmiMI CAYNNNNRTG 1 cut(s) 230
Sse9I AATT 1 cut(s) 255
SspMI CTAG 1 cut(s) 155
TaqI TCGA 3 cut(s) 14, 49, 53
TasI AATT 1 cut(s) 255
TfiI GAWTC 2 cut(s) 16, 46
TspGWI ACGGA 1 cut(s) 61
XspI CTAG 1 cut(s) 155
Zsp2I ATGCAT 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.