Prupe.3G010000_v2.0.a1

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Forward (+)
644354 .. 645140
787 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G010000.1

Sequence Viewer

Length: 306 bp
ATGGATATTGTTGTTGAAATGGATTCTATCAATGCCGTTAATCTTATCTTGAGTAATGATCTGAATATTTGTCATCCTATGGCTGGTTTGGTTCACAGCTGCAAGAGACTTCTGAGCCAAATTCCAAAATGTTTTCTTCACCACATCTACAGAGAAAAGAACGCTGTAGCTGACAGATTGGCTGCTTGGAGCCACGACATTGATCTGGGGTGCTGGTTTCTTGAGGATAATCCGACTTGGCTTAGGCCTCTGTTATTGGATGACTCAATAGGGGTTACTAAGACCCGTATTATTAGTTCTATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.47

Weight (kDa)

5.87

Isoelectric Point (pI)

40.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020123)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g21311
prunus_persica Prupe.3G010000_v2.0.a1 Prupe.4G174500_v2.0.a1 Prupe.6G123500_v2.0.a1
pyrus_communis pycom10g09650
rosa_rugosa Rorug02G0245200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 120
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 1 cut(s) 17
AluBI AGCT 2 cut(s) 99, 170
AluI AGCT 2 cut(s) 99, 170
Alw26I GTCTC 1 cut(s) 100
AoxI GGCC 1 cut(s) 245
ApeKI GCWGC 2 cut(s) 99, 182
ApoI RAATTY 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 131
BbvI GCAGC 2 cut(s) 86, 169
BceAI ACGGC 1 cut(s) 20
BcoDI GTCTC 1 cut(s) 100
BfmI CTRYAG 2 cut(s) 148, 165
BisI GCNGC 2 cut(s) 100, 183
BlsI GCNGC 2 cut(s) 101, 184
BmiI GGNNCC 1 cut(s) 191
Bpu10I CCTNAGC 1 cut(s) 242
BpuEI CTTGAG 2 cut(s) 70, 242
Bsc4I CCNNNNNNNGG 1 cut(s) 83
BseGI GGATG 2 cut(s) 73, 265
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMII CTCAG 1 cut(s) 104
BseXI GCAGC 2 cut(s) 86, 169
BshFI GGCC 1 cut(s) 247
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 100
BsnI GGCC 1 cut(s) 247
Bsp143I GATC 2 cut(s) 58, 202
BspANI GGCC 1 cut(s) 247
BspCNI CTCAG 1 cut(s) 105
BspLI GGNNCC 1 cut(s) 191
BssMI GATC 2 cut(s) 58, 202
BstDEI CTNAG 3 cut(s) 113, 242, 279
BstF5I GGATG 2 cut(s) 73, 265
BstKTI GATC 2 cut(s) 61, 205
BstMAI GTCTC 1 cut(s) 100
BstMBI GATC 2 cut(s) 58, 202
BstSFI CTRYAG 2 cut(s) 148, 165
BstV1I GCAGC 2 cut(s) 86, 169
BsuRI GGCC 1 cut(s) 247
BtsCI GGATG 2 cut(s) 73, 265
CviJI RGCY 8 cut(s) 83, 99, 117, 170, 182, 192, 241, 247
CviKI_1 RGCY 8 cut(s) 83, 99, 117, 170, 182, 192, 241, 247
DdeI CTNAG 3 cut(s) 113, 242, 279
DpnI GATC 2 cut(s) 60, 204
DpnII GATC 2 cut(s) 58, 202
Eco147I AGGCCT 1 cut(s) 247
FaiI YATR 1 cut(s) 80
Fnu4HI GCNGC 2 cut(s) 100, 183
FokI GGATG 2 cut(s) 60, 272
Fsp4HI GCNGC 2 cut(s) 100, 183
GluI GCNGC 2 cut(s) 100, 183
HaeIII GGCC 1 cut(s) 247
HinfI GANTC 2 cut(s) 23, 263
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 3 cut(s) 63, 114, 234
Hpy188III TCNNGA 2 cut(s) 49, 221
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 102
HpyF3I CTNAG 3 cut(s) 113, 242, 279
Kzo9I GATC 2 cut(s) 58, 202
LmnI GCTCC 1 cut(s) 189
LpnPI CCDG 3 cut(s) 69, 191, 199
Lsp1109I GCAGC 2 cut(s) 86, 169
MaeIII GTNAC 1 cut(s) 274
MalI GATC 2 cut(s) 60, 204
MboI GATC 2 cut(s) 58, 202
MboII GAAGA 1 cut(s) 128
MluCI AATT 1 cut(s) 120
MlyI GAGTC 1 cut(s) 257
MmeI TCCRAC 1 cut(s) 257
MnlI CCTC 2 cut(s) 217, 258
MseI TTAA 1 cut(s) 39
MspA1I CMGCKG 1 cut(s) 99
NdeII GATC 2 cut(s) 58, 202
NlaIV GGNNCC 1 cut(s) 191
PceI AGGCCT 1 cut(s) 247
PfeI GAWTC 1 cut(s) 23
PkrI GCNGC 2 cut(s) 101, 184
PleI GAGTC 1 cut(s) 257
PpsI GAGTC 1 cut(s) 257
PspN4I GGNNCC 1 cut(s) 191
PsrI GAACNNNNNNTAC 1 cut(s) 280
PvuII CAGCTG 1 cut(s) 99
SaqAI TTAA 1 cut(s) 39
SatI GCNGC 2 cut(s) 100, 183
Sau3AI GATC 2 cut(s) 58, 202
SchI GAGTC 1 cut(s) 257
SetI ASST 2 cut(s) 101, 172
SfcI CTRYAG 2 cut(s) 148, 165
SmlI CTYRAG 2 cut(s) 49, 221
SmoI CTYRAG 2 cut(s) 49, 221
Sse9I AATT 1 cut(s) 120
SseBI AGGCCT 1 cut(s) 247
SspI AATATT 1 cut(s) 67
StuI AGGCCT 1 cut(s) 247
TasI AATT 1 cut(s) 120
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TseI GCWGC 2 cut(s) 99, 182
XapI RAATTY 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.