Prupe.4G174500_v2.0.a1

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
10325788 .. 10326614
827 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G174500.1

Sequence Viewer

Length: 306 bp
ATGGATATTGTTGTTGAAATGGATTCTGTCAATGCCGTTAATCTTATCCTGAGTAATGATCTGAATTTTTGTCATCCTATGGCTGGTTTGGTTCACAGCTGCAAGAGACTTATGAGCCAAATTCCAAAATGTTTTCTTCACCACATCTACAGAGAGAAGAACGCTGTAGCTGACAGATTGGCTGCTTGGAGCCACGACATTGATCTGGGGTGCTGGTTCCTTGAGGATAATCCGACTTGGCTTGGGCCTCTGTTATTGGATGACTCTATAGGGGTTACTGAGACCCGTATTATTAGTTCTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.39

Weight (kDa)

5.08

Isoelectric Point (pI)

36.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020123)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g21311
prunus_persica Prupe.3G010000_v2.0.a1 Prupe.4G174500_v2.0.a1 Prupe.6G123500_v2.0.a1
pyrus_communis pycom10g09650
rosa_rugosa Rorug02G0245200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 64, 120
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 1 cut(s) 17
AluBI AGCT 2 cut(s) 99, 170
AluI AGCT 2 cut(s) 99, 170
Alw26I GTCTC 2 cut(s) 100, 275
AoxI GGCC 1 cut(s) 245
ApeKI GCWGC 2 cut(s) 99, 182
ApoI RAATTY 2 cut(s) 64, 120
AspS9I GGNCC 1 cut(s) 245
AsuHPI GGTGA 1 cut(s) 131
BbvI GCAGC 2 cut(s) 86, 169
BceAI ACGGC 1 cut(s) 20
BcoDI GTCTC 2 cut(s) 100, 275
BfmI CTRYAG 3 cut(s) 148, 165, 267
BisI GCNGC 2 cut(s) 100, 183
BlsI GCNGC 2 cut(s) 101, 184
BmgT120I GGNCC 1 cut(s) 245
BmiI GGNNCC 2 cut(s) 191, 218
BpuEI CTTGAG 1 cut(s) 242
BsaI GGTCTC 1 cut(s) 275
Bsc4I CCNNNNNNNGG 1 cut(s) 83
BseGI GGATG 2 cut(s) 73, 265
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMII CTCAG 2 cut(s) 41, 270
BseXI GCAGC 2 cut(s) 86, 169
BshFI GGCC 1 cut(s) 247
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 2 cut(s) 100, 275
BsnI GGCC 1 cut(s) 247
Bso31I GGTCTC 1 cut(s) 275
Bsp143I GATC 2 cut(s) 58, 202
BspANI GGCC 1 cut(s) 247
BspCNI CTCAG 2 cut(s) 42, 271
BspLI GGNNCC 2 cut(s) 191, 218
BspTNI GGTCTC 1 cut(s) 275
BssMI GATC 2 cut(s) 58, 202
BstDEI CTNAG 2 cut(s) 50, 279
BstF5I GGATG 2 cut(s) 73, 265
BstKTI GATC 2 cut(s) 61, 205
BstMAI GTCTC 2 cut(s) 100, 275
BstMBI GATC 2 cut(s) 58, 202
BstSFI CTRYAG 3 cut(s) 148, 165, 267
BstV1I GCAGC 2 cut(s) 86, 169
BsuRI GGCC 1 cut(s) 247
BtsCI GGATG 2 cut(s) 73, 265
Cfr13I GGNCC 1 cut(s) 245
CviJI RGCY 8 cut(s) 83, 99, 117, 170, 182, 192, 241, 247
CviKI_1 RGCY 8 cut(s) 83, 99, 117, 170, 182, 192, 241, 247
DdeI CTNAG 2 cut(s) 50, 279
DpnI GATC 2 cut(s) 60, 204
DpnII GATC 2 cut(s) 58, 202
Eco31I GGTCTC 1 cut(s) 275
FaiI YATR 3 cut(s) 80, 113, 269
Fnu4HI GCNGC 2 cut(s) 100, 183
FokI GGATG 2 cut(s) 60, 272
Fsp4HI GCNGC 2 cut(s) 100, 183
GluI GCNGC 2 cut(s) 100, 183
HaeIII GGCC 1 cut(s) 247
HinfI GANTC 2 cut(s) 23, 263
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 63, 234
Hpy188III TCNNGA 1 cut(s) 49
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 102
HpyF3I CTNAG 2 cut(s) 50, 279
Kzo9I GATC 2 cut(s) 58, 202
LmnI GCTCC 1 cut(s) 189
LpnPI CCDG 4 cut(s) 62, 69, 191, 199
Lsp1109I GCAGC 2 cut(s) 86, 169
MaeIII GTNAC 1 cut(s) 274
MalI GATC 2 cut(s) 60, 204
MboI GATC 2 cut(s) 58, 202
MboII GAAGA 2 cut(s) 128, 169
MluCI AATT 2 cut(s) 64, 120
MlyI GAGTC 1 cut(s) 257
MmeI TCCRAC 1 cut(s) 257
MnlI CCTC 2 cut(s) 217, 258
MseI TTAA 1 cut(s) 39
MspA1I CMGCKG 1 cut(s) 99
NdeII GATC 2 cut(s) 58, 202
NlaIV GGNNCC 2 cut(s) 191, 218
PfeI GAWTC 1 cut(s) 23
PkrI GCNGC 2 cut(s) 101, 184
PleI GAGTC 1 cut(s) 257
PpsI GAGTC 1 cut(s) 257
PspN4I GGNNCC 2 cut(s) 191, 218
PspPI GGNCC 1 cut(s) 245
PsrI GAACNNNNNNTAC 1 cut(s) 280
PvuII CAGCTG 1 cut(s) 99
SaqAI TTAA 1 cut(s) 39
SatI GCNGC 2 cut(s) 100, 183
Sau3AI GATC 2 cut(s) 58, 202
Sau96I GGNCC 1 cut(s) 245
SchI GAGTC 1 cut(s) 257
SetI ASST 2 cut(s) 101, 172
SfcI CTRYAG 3 cut(s) 148, 165, 267
SmlI CTYRAG 1 cut(s) 221
SmoI CTYRAG 1 cut(s) 221
Sse9I AATT 2 cut(s) 64, 120
TasI AATT 2 cut(s) 64, 120
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TseI GCWGC 2 cut(s) 99, 182
XapI RAATTY 2 cut(s) 64, 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.