Prupe.3G219200_v2.0.a1
MYB Family

Transcription factor CPC-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
22042848 .. 22043639
792 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G219200.1

Sequence Viewer

Length: 225 bp
ATGGCTGACTTGGATCACTCCACCTCTGATGACAATTCTGTGGATTCTAGAGAGGAAAGTAGTCAAGACTCTAAGCTTCACTTCTCAGAAGATGAGGAAACTCTAATCACTAGGATGTTTAACCTGGTTGGTGAGAGGTGGTCTCTGATTGCTGGTAGAATTCCTGGAAGATCAGCAGAGGAGATTGAAAAGTACTGGACTTCAAGATACTCAACAAGTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.53

Weight (kDa)

4.51

Isoelectric Point (pI)

62.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015673)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 21
AcsI RAATTY 1 cut(s) 159
AfaI GTAC 1 cut(s) 194
AgsI TTSAA 2 cut(s) 188, 204
AjnI CCWGG 2 cut(s) 123, 163
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
Alw26I GTCTC 1 cut(s) 147
AlwI GGATC 1 cut(s) 21
ApoI RAATTY 1 cut(s) 159
AsuHPI GGTGA 1 cut(s) 143
BciT130I CCWGG 2 cut(s) 125, 165
BcoDI GTCTC 1 cut(s) 147
BfaI CTAG 2 cut(s) 48, 111
BmcAI AGTACT 1 cut(s) 194
Bme1390I CCNGG 2 cut(s) 125, 165
BmrFI CCNGG 2 cut(s) 125, 165
BplI GAGNNNNNCTC 2 cut(s) 127, 159
BsaI GGTCTC 1 cut(s) 147
Bse1I ACTGG 1 cut(s) 200
BseBI CCWGG 2 cut(s) 125, 165
BseGI GGATG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 99
BseNI ACTGG 1 cut(s) 200
BseRI GAGGAG 1 cut(s) 194
BsmAI GTCTC 1 cut(s) 147
Bso31I GGTCTC 1 cut(s) 147
Bsp143I GATC 2 cut(s) 13, 170
BspCNI CTCAG 1 cut(s) 98
BspPI GGATC 1 cut(s) 21
BspTNI GGTCTC 1 cut(s) 147
BsrI ACTGG 1 cut(s) 200
BssMI GATC 2 cut(s) 13, 170
Bst2UI CCWGG 2 cut(s) 125, 165
BstDEI CTNAG 2 cut(s) 72, 85
BstF5I GGATG 1 cut(s) 120
BstKTI GATC 2 cut(s) 16, 173
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 2 cut(s) 13, 170
BstNI CCWGG 2 cut(s) 125, 165
BstSCI CCNGG 2 cut(s) 123, 163
BtsCI GGATG 1 cut(s) 120
CsiI ACCWGGT 1 cut(s) 123
Csp6I GTAC 1 cut(s) 193
CviJI RGCY 2 cut(s) 5, 76
CviKI_1 RGCY 2 cut(s) 5, 76
CviQI GTAC 1 cut(s) 193
DdeI CTNAG 2 cut(s) 72, 85
DpnI GATC 2 cut(s) 15, 172
DpnII GATC 2 cut(s) 13, 170
Eco31I GGTCTC 1 cut(s) 147
EcoRI GAATTC 1 cut(s) 159
EcoRII CCWGG 2 cut(s) 123, 163
FalI AAGNNNNNCTT 2 cut(s) 65, 97
FokI GGATG 1 cut(s) 127
FspBI CTAG 2 cut(s) 48, 111
HindIII AAGCTT 1 cut(s) 74
HinfI GANTC 2 cut(s) 44, 68
HphI GGTGA 1 cut(s) 143
Hpy188I TCNGA 3 cut(s) 28, 88, 147
Hpy188III TCNNGA 3 cut(s) 48, 65, 204
HpyF3I CTNAG 2 cut(s) 72, 85
Kzo9I GATC 2 cut(s) 13, 170
LpnPI CCDG 6 cut(s) 110, 137, 138, 150, 177, 181
MabI ACCWGGT 1 cut(s) 123
MaeI CTAG 2 cut(s) 48, 111
MalI GATC 2 cut(s) 15, 172
MboI GATC 2 cut(s) 13, 170
MboII GAAGA 2 cut(s) 101, 180
MluCI AATT 2 cut(s) 34, 159
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 5 cut(s) 34, 46, 88, 129, 172
MseI TTAA 1 cut(s) 120
MslI CAYNNNNRTG 1 cut(s) 113
MspR9I CCNGG 2 cut(s) 125, 165
MvaI CCWGG 2 cut(s) 125, 165
NdeII GATC 2 cut(s) 13, 170
PfeI GAWTC 1 cut(s) 44
PfoI TCCNGGA 1 cut(s) 163
PleI GAGTC 1 cut(s) 62
PpsI GAGTC 1 cut(s) 62
Psp6I CCWGG 2 cut(s) 123, 163
PspGI CCWGG 2 cut(s) 123, 163
RsaI GTAC 1 cut(s) 194
RsaNI GTAC 1 cut(s) 193
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 2 cut(s) 13, 170
ScaI AGTACT 1 cut(s) 194
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 2 cut(s) 125, 165
SetI ASST 4 cut(s) 26, 78, 126, 140
SexAI ACCWGGT 1 cut(s) 123
SmiMI CAYNNNNRTG 1 cut(s) 113
Sse9I AATT 2 cut(s) 34, 159
SspMI CTAG 2 cut(s) 48, 111
StyD4I CCNGG 2 cut(s) 123, 163
TasI AATT 2 cut(s) 34, 159
TatI WGTACW 1 cut(s) 192
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
XapI RAATTY 1 cut(s) 159
XbaI TCTAGA 1 cut(s) 47
XspI CTAG 2 cut(s) 48, 111
ZrmI AGTACT 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.