Rh2BG559000
MYB Family

Transcription factor CPC-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
76989161 .. 76989849
689 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG559000.1

Sequence Viewer

Length: 225 bp
ATGGCTGACTTGGATCACTCTTCTGATGAAAGCTCCGTGGATTCCAGAGCAGAGGATACTAGTCAAGACTCTAAGCTCGACTTTTCAGAAGATGAGGAATTTCTTATCACTAGGATGTTTAACCTGGTTGGGGAGAGGTGGTCTTTGATTGCTGGAAGAATTCCTGGAAGATCAGCAGAGGAGATTGAGAAGTACTGGAATTCAAGATACTCAACAAGTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.52

Weight (kDa)

4.34

Isoelectric Point (pI)

65.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 26 - 68 3.2e-10 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015673)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 21
AcsI RAATTY 3 cut(s) 98, 159, 199
AfaI GTAC 1 cut(s) 194
AfiI CCNNNNNNNGG 1 cut(s) 130
AgsI TTSAA 1 cut(s) 204
AhlI ACTAGT 1 cut(s) 59
AjnI CCWGG 2 cut(s) 123, 163
AluBI AGCT 2 cut(s) 33, 76
AluI AGCT 2 cut(s) 33, 76
AlwI GGATC 1 cut(s) 21
ApoI RAATTY 3 cut(s) 98, 159, 199
BciT130I CCWGG 2 cut(s) 125, 165
BciVI GTATCC 1 cut(s) 49
BcuI ACTAGT 1 cut(s) 59
BfaI CTAG 2 cut(s) 60, 111
BfuI GTATCC 1 cut(s) 49
BmcAI AGTACT 1 cut(s) 194
Bme1390I CCNGG 2 cut(s) 125, 165
BmrFI CCNGG 2 cut(s) 125, 165
BsaJI CCNNGG 1 cut(s) 36
BsaXI ACNNNNNCTCC 2 cut(s) 125, 155
Bsc4I CCNNNNNNNGG 1 cut(s) 130
Bse1I ACTGG 1 cut(s) 200
BseBI CCWGG 2 cut(s) 125, 165
BseDI CCNNGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 120
BseLI CCNNNNNNNGG 1 cut(s) 130
BseNI ACTGG 1 cut(s) 200
BseRI GAGGAG 1 cut(s) 194
BslI CCNNNNNNNGG 1 cut(s) 130
Bsp143I GATC 2 cut(s) 13, 170
BspPI GGATC 1 cut(s) 21
BsrI ACTGG 1 cut(s) 200
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 2 cut(s) 13, 170
Bst2UI CCWGG 2 cut(s) 125, 165
Bst6I CTCTTC 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 72
BstDSI CCRYGG 1 cut(s) 36
BstF5I GGATG 1 cut(s) 120
BstKTI GATC 2 cut(s) 16, 173
BstMBI GATC 2 cut(s) 13, 170
BstNI CCWGG 2 cut(s) 125, 165
BstSCI CCNGG 2 cut(s) 123, 163
BsuI GTATCC 1 cut(s) 49
BtgI CCRYGG 1 cut(s) 36
BtsCI GGATG 1 cut(s) 120
CsiI ACCWGGT 1 cut(s) 123
Csp6I GTAC 1 cut(s) 193
CviJI RGCY 3 cut(s) 5, 33, 76
CviKI_1 RGCY 3 cut(s) 5, 33, 76
CviQI GTAC 1 cut(s) 193
DdeI CTNAG 1 cut(s) 72
DpnI GATC 2 cut(s) 15, 172
DpnII GATC 2 cut(s) 13, 170
Eam1104I CTCTTC 1 cut(s) 25
EarI CTCTTC 1 cut(s) 25
EcoRI GAATTC 2 cut(s) 159, 199
EcoRII CCWGG 2 cut(s) 123, 163
FalI AAGNNNNNCTT 2 cut(s) 65, 97
FokI GGATG 1 cut(s) 127
FspBI CTAG 2 cut(s) 60, 111
HinfI GANTC 2 cut(s) 41, 68
Hpy188I TCNGA 2 cut(s) 25, 88
Hpy188III TCNNGA 3 cut(s) 45, 65, 204
HpyF3I CTNAG 1 cut(s) 72
Kzo9I GATC 2 cut(s) 13, 170
LmnI GCTCC 1 cut(s) 38
LpnPI CCDG 7 cut(s) 58, 110, 137, 138, 150, 177, 181
MabI ACCWGGT 1 cut(s) 123
MaeI CTAG 2 cut(s) 60, 111
MalI GATC 2 cut(s) 15, 172
MboI GATC 2 cut(s) 13, 170
MboII GAAGA 4 cut(s) 12, 101, 168, 180
MluCI AATT 3 cut(s) 98, 159, 199
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 4 cut(s) 46, 88, 129, 172
MseI TTAA 1 cut(s) 120
MslI CAYNNNNRTG 1 cut(s) 113
MspR9I CCNGG 2 cut(s) 125, 165
MvaI CCWGG 2 cut(s) 125, 165
NdeII GATC 2 cut(s) 13, 170
PfeI GAWTC 1 cut(s) 41
PfoI TCCNGGA 1 cut(s) 163
PleI GAGTC 1 cut(s) 62
PpsI GAGTC 1 cut(s) 62
Psp6I CCWGG 2 cut(s) 123, 163
PspGI CCWGG 2 cut(s) 123, 163
RsaI GTAC 1 cut(s) 194
RsaNI GTAC 1 cut(s) 193
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 2 cut(s) 13, 170
ScaI AGTACT 1 cut(s) 194
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 2 cut(s) 125, 165
SetI ASST 4 cut(s) 35, 78, 126, 140
SexAI ACCWGGT 1 cut(s) 123
SmiMI CAYNNNNRTG 1 cut(s) 113
SpeI ACTAGT 1 cut(s) 59
Sse9I AATT 3 cut(s) 98, 159, 199
SspMI CTAG 2 cut(s) 60, 111
StyD4I CCNGG 2 cut(s) 123, 163
TaqI TCGA 1 cut(s) 78
TasI AATT 3 cut(s) 98, 159, 199
TatI WGTACW 1 cut(s) 192
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 42
TspGWI ACGGA 1 cut(s) 25
XapI RAATTY 3 cut(s) 98, 159, 199
XspI CTAG 2 cut(s) 60, 111
ZrmI AGTACT 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.