pycom10g26710
MYB Family

MYB-like transcription factor ETC1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
27959754 .. 27960775
1022 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g26710.2

Sequence Viewer

Length: 225 bp
ATGGCGGACTCCGAGCACTCTTCTTCGGATGACACACACTCGGACTCTCGAGAGAAAAGTACAGAAAAATCTGAGCTTCAATTCTCCCAGGATGAGGAAGCGCTTATCATAAGAATGTACAATCTAGTAGGGGAGAGGTGGGCTTTGATTGCCGGGAGGATTCCGGGGAGAACAGCAGAAGAAATTGAGAAGTATTGGACCTCTACATACTCAACTAGTCAATAA

Protein Analysis

75

Amino Acids

8.49

Weight (kDa)

4.63

Isoelectric Point (pI)

59.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015673)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AfaI GTAC 2 cut(s) 61, 119
AfeI AGCGCT 1 cut(s) 102
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 1 cut(s) 80
AhlI ACTAGT 1 cut(s) 215
AjnI CCWGG 1 cut(s) 87
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
Alw21I GWGCWC 1 cut(s) 18
Ama87I CYCGRG 1 cut(s) 48
Aor51HI AGCGCT 1 cut(s) 102
AspLEI GCGC 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 198
AsuC2I CCSGG 2 cut(s) 154, 165
AvaI CYCGRG 1 cut(s) 48
AvaII GGWCC 1 cut(s) 198
Bbv12I GWGCWC 1 cut(s) 18
BciT130I CCWGG 1 cut(s) 89
BcnI CCSGG 2 cut(s) 154, 165
BcuI ACTAGT 1 cut(s) 215
BfaI CTAG 2 cut(s) 125, 216
BfoI RGCGCY 1 cut(s) 104
Bme1390I CCNGG 3 cut(s) 89, 154, 165
Bme18I GGWCC 1 cut(s) 198
BmeT110I CYCGRG 1 cut(s) 48
BmgT120I GGNCC 1 cut(s) 198
BmrFI CCNGG 3 cut(s) 89, 154, 165
BpuMI CCSGG 2 cut(s) 154, 165
BsaJI CCNNGG 2 cut(s) 87, 164
Bsc4I CCNNNNNNNGG 1 cut(s) 94
BseBI CCWGG 1 cut(s) 89
BseDI CCNNGG 2 cut(s) 87, 164
BseGI GGATG 2 cut(s) 34, 97
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 63
BsiHKAI GWGCWC 1 cut(s) 18
BsiHKCI CYCGRG 1 cut(s) 48
BsiSI CCGG 2 cut(s) 153, 164
BslI CCNNNNNNNGG 1 cut(s) 94
BsoBI CYCGRG 1 cut(s) 48
Bsp1286I GDGCHC 1 cut(s) 18
Bsp1407I TGTACA 1 cut(s) 117
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 64
BsrGI TGTACA 1 cut(s) 117
BssECI CCNNGG 2 cut(s) 87, 164
Bst2UI CCWGG 1 cut(s) 89
Bst6I CTCTTC 1 cut(s) 25
BstAUI TGTACA 1 cut(s) 117
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 2 cut(s) 34, 97
BstH2I RGCGCY 1 cut(s) 104
BstHHI GCGC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstNI CCWGG 1 cut(s) 89
BstSCI CCNGG 3 cut(s) 87, 152, 163
BtsCI GGATG 2 cut(s) 34, 97
CfoI GCGC 1 cut(s) 103
Cfr13I GGNCC 1 cut(s) 198
Csp6I GTAC 2 cut(s) 60, 118
CviJI RGCY 2 cut(s) 76, 143
CviKI_1 RGCY 2 cut(s) 76, 143
CviQI GTAC 2 cut(s) 60, 118
DdeI CTNAG 1 cut(s) 72
Eam1104I CTCTTC 1 cut(s) 25
EarI CTCTTC 1 cut(s) 25
EciI GGCGGA 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 198
Eco47III AGCGCT 1 cut(s) 102
Eco88I CYCGRG 1 cut(s) 48
EcoRII CCWGG 1 cut(s) 87
FaiI YATR 2 cut(s) 110, 208
FokI GGATG 2 cut(s) 41, 104
FspBI CTAG 2 cut(s) 125, 216
GlaI GCGC 1 cut(s) 102
HaeII RGCGCY 1 cut(s) 104
HapII CCGG 2 cut(s) 153, 164
HhaI GCGC 1 cut(s) 103
Hin6I GCGC 1 cut(s) 101
HinP1I GCGC 1 cut(s) 101
HinfI GANTC 3 cut(s) 8, 44, 160
HpaII CCGG 2 cut(s) 153, 164
Hpy188I TCNGA 4 cut(s) 13, 28, 43, 73
Hpy188III TCNNGA 2 cut(s) 48, 50
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
HpyF3I CTNAG 1 cut(s) 72
HspAI GCGC 1 cut(s) 101
LpnPI CCDG 4 cut(s) 74, 101, 166, 177
MaeI CTAG 2 cut(s) 125, 216
MboII GAAGA 3 cut(s) 12, 15, 191
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 2 cut(s) 80, 183
MlyI GAGTC 2 cut(s) 2, 38
MnlI CCTC 4 cut(s) 88, 129, 150, 211
MslI CAYNNNNRTG 1 cut(s) 113
MspI CCGG 2 cut(s) 153, 164
MspR9I CCNGG 3 cut(s) 89, 154, 165
MvaI CCWGG 1 cut(s) 89
MwoI GCNNNNNNNGC 1 cut(s) 149
NciI CCSGG 2 cut(s) 154, 165
PaeR7I CTCGAG 1 cut(s) 48
PfeI GAWTC 1 cut(s) 160
PleI GAGTC 2 cut(s) 2, 38
PpsI GAGTC 2 cut(s) 2, 38
Psp6I CCWGG 1 cut(s) 87
PspGI CCWGG 1 cut(s) 87
PspPI GGNCC 1 cut(s) 198
RsaI GTAC 2 cut(s) 61, 119
RsaNI GTAC 2 cut(s) 60, 118
RseI CAYNNNNRTG 1 cut(s) 113
Sau96I GGNCC 1 cut(s) 198
SchI GAGTC 2 cut(s) 2, 38
ScrFI CCNGG 3 cut(s) 89, 154, 165
SduI GDGCHC 1 cut(s) 18
SetI ASST 3 cut(s) 78, 140, 203
Sfr274I CTCGAG 1 cut(s) 48
SinI GGWCC 1 cut(s) 198
SlaI CTCGAG 1 cut(s) 48
SmiMI CAYNNNNRTG 1 cut(s) 113
SmlI CTYRAG 1 cut(s) 48
SmoI CTYRAG 1 cut(s) 48
SpeI ACTAGT 1 cut(s) 215
Sse9I AATT 2 cut(s) 80, 183
SsiI CCGC 1 cut(s) 5
SspMI CTAG 2 cut(s) 125, 216
StyD4I CCNGG 3 cut(s) 87, 152, 163
TaqI TCGA 1 cut(s) 49
TasI AATT 2 cut(s) 80, 183
TatI WGTACW 2 cut(s) 59, 117
TfiI GAWTC 1 cut(s) 160
VpaK11BI GGWCC 1 cut(s) 198
XhoI CTCGAG 1 cut(s) 48
XspI CTAG 2 cut(s) 125, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.