Prupe.3G292200_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
OG0015478
Physical Location & Seq
Forward (+)
26175543 .. 26178196
2654 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G292200.1

Sequence Viewer

Length: 339 bp
ATGGCCATGGTGTCCTGGAACCTGGGCGTGGGTCCACACCCAAAGCTACTTCAAGTCTCTTGCAGAAAGAAAGAGAGGAACAGAGATAACATTCACCCTTACAAAGTAATCGAAATAACGCCTCCGCCCAAGAACCTTGGCATTCGATGCTTTCCCTCCAACCTACAATGTGGGGAGAGTGTGACAATAGAAGGCCAAACTTACACAATCTCAGCTGTAACTCATAGGTACCAGCTTCGGAAGGGGAAGTACGAACCGAGTGAGAAGAGGCTTGATGTTTTGTCCTCGGCGAGATATATCTTAAATTTGTACTTGGAAAATTTACTAGAACAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.87

Weight (kDa)

9.4

Isoelectric Point (pI)

52.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015478)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G40500 AT5G40500
fragaria_vesca FvH4_6g51480 FvH4_6g51480
malus_domestica MD17G1026500.v1.1
prunus_persica Prupe.3G292200_v2.0.a1
pyrus_communis pycom17g02160
rosa_chinensis RchiOBHm_Chr2g0173121
rosa_laevigata RLG00000022160
rosa_roxburghii Rroxscaffold_2G00079220
rosa_rugosa Rorug02G0565500
rosa_samantha Rh2AG645500 Rh2BG656200 Rh2CG621300 Rh2DG669600
rosa_wichuraiana Rw2G053010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 228
AccB1I GGYRCC 1 cut(s) 228
AciI CCGC 1 cut(s) 125
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 304, 319
AfaI GTAC 3 cut(s) 230, 251, 311
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 1 cut(s) 53
AjnI CCWGG 2 cut(s) 14, 21
AluBI AGCT 3 cut(s) 46, 215, 235
AluI AGCT 3 cut(s) 46, 215, 235
Alw26I GTCTC 1 cut(s) 61
AoxI GGCC 2 cut(s) 3, 193
ApoI RAATTY 2 cut(s) 304, 319
Asp718I GGTACC 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 32
AsuHPI GGTGA 1 cut(s) 86
AvaII GGWCC 1 cut(s) 32
BalI TGGCCA 1 cut(s) 5
BanI GGYRCC 1 cut(s) 228
BarI GAAGNNNNNNTAC 2 cut(s) 233, 265
BciT130I CCWGG 2 cut(s) 16, 23
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 1 cut(s) 326
Bme1390I CCNGG 2 cut(s) 16, 23
Bme18I GGWCC 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 32
BmiI GGNNCC 3 cut(s) 20, 33, 230
BmrFI CCNGG 2 cut(s) 16, 23
BmsI GCATC 1 cut(s) 137
BsaJI CCNNGG 4 cut(s) 6, 22, 136, 285
Bsc4I CCNNNNNNNGG 1 cut(s) 28
BseBI CCWGG 2 cut(s) 16, 23
BseDI CCNNGG 4 cut(s) 6, 22, 136, 285
BseLI CCNNNNNNNGG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 225
BshFI GGCC 2 cut(s) 5, 195
BshNI GGYRCC 1 cut(s) 228
BslI CCNNNNNNNGG 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 61
BsmI GAATGC 1 cut(s) 141
BsnI GGCC 2 cut(s) 5, 195
Bsp19I CCATGG 1 cut(s) 6
BspACI CCGC 1 cut(s) 125
BspANI GGCC 2 cut(s) 5, 195
BspCNI CTCAG 1 cut(s) 224
BspLI GGNNCC 3 cut(s) 20, 33, 230
BspT107I GGYRCC 1 cut(s) 228
BssECI CCNNGG 4 cut(s) 6, 22, 136, 285
BssT1I CCWWGG 2 cut(s) 6, 136
Bst2UI CCWGG 2 cut(s) 16, 23
Bst6I CTCTTC 1 cut(s) 260
BstAPI GCANNNNNTGC 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 211
BstDSI CCRYGG 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 147
BstNI CCWGG 2 cut(s) 16, 23
BstSCI CCNGG 2 cut(s) 14, 21
BsuRI GGCC 2 cut(s) 5, 195
BtgI CCRYGG 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 32
Csp6I GTAC 3 cut(s) 229, 250, 310
CviAII CATG 1 cut(s) 7
CviJI RGCY 6 cut(s) 5, 46, 195, 215, 235, 271
CviKI_1 RGCY 6 cut(s) 5, 46, 195, 215, 235, 271
CviQI GTAC 3 cut(s) 229, 250, 310
DdeI CTNAG 1 cut(s) 211
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 260
EarI CTCTTC 1 cut(s) 260
EciI GGCGGA 1 cut(s) 114
Eco130I CCWWGG 2 cut(s) 6, 136
Eco47I GGWCC 1 cut(s) 32
EcoRII CCWGG 2 cut(s) 14, 21
EcoT14I CCWWGG 2 cut(s) 6, 136
ErhI CCWWGG 2 cut(s) 6, 136
FaeI CATG 1 cut(s) 10
FaiI YATR 3 cut(s) 8, 225, 297
FatI CATG 1 cut(s) 6
FspBI CTAG 1 cut(s) 326
HaeIII GGCC 2 cut(s) 5, 195
Hin1II CATG 1 cut(s) 10
HphI GGTGA 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 35
Hpy188I TCNGA 1 cut(s) 240
Hpy188III TCNNGA 1 cut(s) 336
Hpy8I GTNNAC 1 cut(s) 35
HpyAV CCTTC 2 cut(s) 185, 235
HpyCH4V TGCA 1 cut(s) 63
HpyF10VI GCNNNNNNNGC 1 cut(s) 147
HpyF3I CTNAG 1 cut(s) 211
Hsp92II CATG 1 cut(s) 10
KpnI GGTACC 1 cut(s) 232
LpnPI CCDG 4 cut(s) 8, 28, 35, 245
LweI GCATC 1 cut(s) 137
MaeI CTAG 1 cut(s) 326
MaeIII GTNAC 2 cut(s) 181, 217
MboII GAAGA 1 cut(s) 277
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 304, 319
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 183
MnlI CCTC 5 cut(s) 69, 132, 166, 261, 295
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 302
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 215
MspR9I CCNGG 2 cut(s) 16, 23
Mva1269I GAATGC 1 cut(s) 141
MvaI CCWGG 2 cut(s) 16, 23
MwoI GCNNNNNNNGC 1 cut(s) 147
NcoI CCATGG 1 cut(s) 6
NlaIII CATG 1 cut(s) 10
NlaIV GGNNCC 3 cut(s) 20, 33, 230
NmeAIII GCCGAG 1 cut(s) 266
NmuCI GTSAC 1 cut(s) 181
PctI GAATGC 1 cut(s) 141
PfoI TCCNGGA 1 cut(s) 14
Psp6I CCWGG 2 cut(s) 14, 21
PspGI CCWGG 2 cut(s) 14, 21
PspN4I GGNNCC 3 cut(s) 20, 33, 230
PspPI GGNCC 1 cut(s) 32
PvuII CAGCTG 1 cut(s) 215
RsaI GTAC 3 cut(s) 230, 251, 311
RsaNI GTAC 3 cut(s) 229, 250, 310
SaqAI TTAA 1 cut(s) 302
Sau96I GGNCC 1 cut(s) 32
ScrFI CCNGG 2 cut(s) 16, 23
SetI ASST 7 cut(s) 24, 48, 138, 165, 217, 230, 237
SfaNI GCATC 1 cut(s) 137
SinI GGWCC 1 cut(s) 32
Sse9I AATT 2 cut(s) 304, 319
SsiI CCGC 1 cut(s) 125
SspMI CTAG 1 cut(s) 326
StyD4I CCNGG 2 cut(s) 14, 21
StyI CCWWGG 2 cut(s) 6, 136
TaqI TCGA 2 cut(s) 111, 145
TasI AATT 2 cut(s) 304, 319
TatI WGTACW 1 cut(s) 309
Tru1I TTAA 1 cut(s) 302
Tru9I TTAA 1 cut(s) 302
TseFI GTSAC 1 cut(s) 181
Tsp45I GTSAC 1 cut(s) 181
VpaK11BI GGWCC 1 cut(s) 32
XapI RAATTY 2 cut(s) 304, 319
XspI CTAG 1 cut(s) 326
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.