Prupe.6G317300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
28204803 .. 28205273
471 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G317300.1

Sequence Viewer

Length: 471 bp
ATGAAGATCAAATCACCAGAGAAAAAGTCTTCCTCCAATGGCAGAAGTTTCATGAAAAGCAAAACCAAGTGCAACAGCAGAGCCAACGATGATGATACTAACCTATGTGCACCTTTTTGTTATATCAAAGGTGATAATGCTGAACGAGTTGATATTGGTGTTGCTCATGCTACTTTCAGGGTGATTGGGGAGCAAGAAAGTTCAGGTAACTTGAATTTGGTTCCATCAAAATTCATGCCAACTAATCGCTGGAAGTCGAGAATGGCAAGGTCCCTAACGAAAATGGTAAGTAGGCAGATCGATTGGGAAGATAATTCAAAGCAAGAAGATAGCAAAGCTATGGAAGAAAGAGGTGCCCAAGAGTTATGCAAGAAAAGGATTCTAATGGGAAGCAAGTGCAGACCACTGAGTTTATCTGGCACCCTTCAGTATGATGAAAATGGCATTTTGATAACTGAGATCATGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

157

Amino Acids

17.6

Weight (kDa)

9.26

Isoelectric Point (pI)

59.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017955)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G27020
fragaria_vesca FvH4_6g07020
prunus_persica Prupe.6G317300_v2.0.a1
pyrus_communis pycom12g19710
rosa_laevigata RLG00000025295
rosa_roxburghii Rroxscaffold_6G00422640
rosa_rugosa Rorug03G0013900
rosa_samantha Rh3AG074500 Rh3BG076200 Rh3CG075900 Rh3DG078000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 353, 419
AcsI RAATTY 2 cut(s) 214, 230
AcuI CTGAAG 1 cut(s) 410
AgsI TTSAA 2 cut(s) 214, 318
AluBI AGCT 1 cut(s) 338
AluI AGCT 1 cut(s) 338
Alw21I GWGCWC 1 cut(s) 112
Alw44I GTGCAC 1 cut(s) 108
ApaLI GTGCAC 1 cut(s) 108
ApoI RAATTY 2 cut(s) 214, 230
AspS9I GGNCC 1 cut(s) 270
AsuHPI GGTGA 3 cut(s) 6, 143, 193
AvaII GGWCC 1 cut(s) 270
BaeGI GKGCMC 2 cut(s) 112, 358
BanI GGYRCC 2 cut(s) 353, 419
BbsI GAAGAC 1 cut(s) 21
Bbv12I GWGCWC 1 cut(s) 112
BccI CCATC 1 cut(s) 232
Bme18I GGWCC 1 cut(s) 270
BmgT120I GGNCC 1 cut(s) 270
BmiI GGNNCC 4 cut(s) 222, 272, 355, 421
BpiI GAAGAC 1 cut(s) 21
Bsa29I ATCGAT 1 cut(s) 300
BseCI ATCGAT 1 cut(s) 300
BseMII CTCAG 2 cut(s) 398, 447
BseSI GKGCMC 2 cut(s) 112, 358
BsgI GTGCAG 1 cut(s) 418
BshNI GGYRCC 2 cut(s) 353, 419
BshVI ATCGAT 1 cut(s) 300
BsiHKAI GWGCWC 1 cut(s) 112
BslFI GGGAC 1 cut(s) 256
BsmFI GGGAC 1 cut(s) 256
Bsp1286I GDGCHC 2 cut(s) 112, 358
Bsp143I GATC 3 cut(s) 6, 297, 459
BspCNI CTCAG 2 cut(s) 399, 448
BspDI ATCGAT 1 cut(s) 300
BspHI TCATGA 1 cut(s) 51
BspLI GGNNCC 4 cut(s) 222, 272, 355, 421
BspT107I GGYRCC 2 cut(s) 353, 419
BssMI GATC 3 cut(s) 6, 297, 459
BstDEI CTNAG 2 cut(s) 407, 456
BstKTI GATC 3 cut(s) 9, 300, 462
BstMBI GATC 3 cut(s) 6, 297, 459
BstSLI GKGCMC 2 cut(s) 112, 358
BstV2I GAAGAC 1 cut(s) 21
Bsu15I ATCGAT 1 cut(s) 300
BsuTUI ATCGAT 1 cut(s) 300
BtsIMutI CAGTG 1 cut(s) 404
CciI TCATGA 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 270
ClaI ATCGAT 1 cut(s) 300
CviAII CATG 5 cut(s) 52, 167, 235, 463, 468
CviJI RGCY 2 cut(s) 83, 338
CviKI_1 RGCY 2 cut(s) 83, 338
DdeI CTNAG 2 cut(s) 407, 456
DpnI GATC 3 cut(s) 8, 299, 461
DpnII GATC 3 cut(s) 6, 297, 459
Eco47I GGWCC 1 cut(s) 270
Eco57I CTGAAG 1 cut(s) 410
EcoO109I RGGNCCY 1 cut(s) 270
FaeI CATG 5 cut(s) 55, 170, 238, 466, 471
FaqI GGGAC 1 cut(s) 256
FatI CATG 5 cut(s) 51, 166, 234, 462, 467
Hin1II CATG 5 cut(s) 55, 170, 238, 466, 471
HinfI GANTC 1 cut(s) 379
HphI GGTGA 3 cut(s) 6, 143, 193
Hpy166II GTNNAC 1 cut(s) 110
Hpy188III TCNNGA 2 cut(s) 52, 258
Hpy8I GTNNAC 1 cut(s) 110
HpyAV CCTTC 1 cut(s) 434
HpyCH4V TGCA 4 cut(s) 72, 110, 369, 399
HpyF3I CTNAG 2 cut(s) 407, 456
Hsp92II CATG 5 cut(s) 55, 170, 238, 466, 471
Kzo9I GATC 3 cut(s) 6, 297, 459
LmnI GCTCC 1 cut(s) 190
LpnPI CCDG 5 cut(s) 30, 163, 189, 235, 402
MaeIII GTNAC 1 cut(s) 206
MalI GATC 3 cut(s) 8, 299, 461
MboI GATC 3 cut(s) 6, 297, 459
MboII GAAGA 5 cut(s) 16, 21, 320, 338, 356
MhlI GDGCHC 2 cut(s) 112, 358
MluCI AATT 3 cut(s) 214, 230, 313
MnlI CCTC 2 cut(s) 43, 344
NdeII GATC 3 cut(s) 6, 297, 459
NlaIII CATG 5 cut(s) 55, 170, 238, 466, 471
NlaIV GGNNCC 4 cut(s) 222, 272, 355, 421
PagI TCATGA 1 cut(s) 51
PfeI GAWTC 1 cut(s) 379
PpuMI RGGWCCY 1 cut(s) 270
Psp5II RGGWCCY 1 cut(s) 270
PspN4I GGNNCC 4 cut(s) 222, 272, 355, 421
PspPI GGNCC 1 cut(s) 270
PspPPI RGGWCCY 1 cut(s) 270
Sau3AI GATC 3 cut(s) 6, 297, 459
Sau96I GGNCC 1 cut(s) 270
SduI GDGCHC 2 cut(s) 112, 358
SetI ASST 7 cut(s) 105, 115, 133, 208, 272, 340, 355
SinI GGWCC 1 cut(s) 270
Sse9I AATT 3 cut(s) 214, 230, 313
TaqI TCGA 2 cut(s) 257, 300
TasI AATT 3 cut(s) 214, 230, 313
TfiI GAWTC 1 cut(s) 379
TscAI CASTG 1 cut(s) 411
TspDTI ATGAA 5 cut(s) 17, 40, 68, 223, 450
TspRI CASTG 1 cut(s) 411
VneI GTGCAC 1 cut(s) 108
VpaK11BI GGWCC 1 cut(s) 270
XapI RAATTY 2 cut(s) 214, 230
XcmI CCANNNNNNNNNTGG 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.