Prupe.7G186200_v2.0.a1
MYB Family

ubiquitin modification-dependent histone binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0017216
Physical Location & Seq
Forward (+)
18003774 .. 18005050
1277 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G186200.1

Sequence Viewer

Length: 534 bp
ATGATTCACCGCCAAATCATAGCAGTTTTGTCCTTCATGAATTTAGACACTAAGATTTATCAACTTTTTTGTAGGTTCTCGAACAACTTATCCCAACCACCCCAACCTGAAAAACCTAATGACGATCAATGGACCTTCGATGAGAACAAGAGGTTTGAAAATGCTCTCACAGAGCTCAATCTTGATGCCCCATACCTCTTTCAGAAACTAAGAACTAGGGTTCCTGGGAAAACTGTTGCACAAGTTAAGAAGCACTTCGAAGCATTATTTGAAGACATTTTGATGATTGAATCAGGTCATATAGCTGTGCCCGAGTACAACAAGATTAGTATTGAAAGCAAAGTTACAACAAAACCATTCAGAAGGAAACGTACTCCATGGACCAAGCATGAACACAAGTTGTTCTTGAAGGGGTTAGAGCAATATGGGAAGGGAGATTGGAGGAGCATTTCCAGGTTCTGCGTAGTAACAAGGACCCCAACTCAAGTTGCAAGTCATGCCCAGAAGTACTTCCTTCGCGTTAATCAACCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

178

Amino Acids

20.91

Weight (kDa)

9.72

Isoelectric Point (pI)

43.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017216)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g10080
prunus_persica Prupe.7G186200_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0096871
rosa_laevigata RLG00000016675
rosa_multiflora Rmu_co8382481.1_g000001 Rmu_ssc0000215.1_g000024
rosa_roxburghii Rroxscaffold_2G00145250
rosa_rugosa Rorug02G0061500
rosa_samantha Rh2AG109000 Rh2BG111100 Rh2CG113200 Rh2DG112300
rosa_wichuraiana Rw2G008440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 519
AciI CCGC 1 cut(s) 10
AcsI RAATTY 1 cut(s) 40
AfaI GTAC 3 cut(s) 317, 373, 509
AgsI TTSAA 5 cut(s) 158, 272, 290, 335, 409
AjnI CCWGG 2 cut(s) 223, 452
AloI GAACNNNNNNTCC 4 cut(s) 74, 106, 205, 237
AluBI AGCT 2 cut(s) 175, 305
AluI AGCT 2 cut(s) 175, 305
Alw21I GWGCWC 1 cut(s) 177
AlwNI CAGNNNCTG 1 cut(s) 459
Ama87I CYCGRG 1 cut(s) 311
ApoI RAATTY 1 cut(s) 40
Asp700I GAANNNNTTC 2 cut(s) 254, 509
AspS9I GGNCC 3 cut(s) 132, 381, 474
AsuII TTCGAA 1 cut(s) 258
AvaI CYCGRG 1 cut(s) 311
AvaII GGWCC 3 cut(s) 132, 381, 474
BaeGI GKGCMC 1 cut(s) 312
BanII GRGCYC 1 cut(s) 177
BarI GAAGNNNNNNTAC 2 cut(s) 355, 387
BbsI GAAGAC 1 cut(s) 279
Bbv12I GWGCWC 1 cut(s) 177
BciT130I CCWGG 2 cut(s) 225, 454
BfaI CTAG 2 cut(s) 216, 532
BmcAI AGTACT 1 cut(s) 509
Bme1390I CCNGG 2 cut(s) 225, 454
Bme18I GGWCC 3 cut(s) 132, 381, 474
BmeT110I CYCGRG 1 cut(s) 311
BmgT120I GGNCC 3 cut(s) 132, 381, 474
BmiI GGNNCC 2 cut(s) 222, 476
BmrFI CCNGG 2 cut(s) 225, 454
BmsI GCATC 1 cut(s) 175
BpiI GAAGAC 1 cut(s) 279
Bpu14I TTCGAA 1 cut(s) 258
BpuEI CTTGAG 1 cut(s) 468
BsaJI CCNNGG 2 cut(s) 224, 377
BseBI CCWGG 2 cut(s) 225, 454
BseDI CCNNGG 2 cut(s) 224, 377
BseRI GAGGAG 1 cut(s) 457
BseSI GKGCMC 1 cut(s) 312
Bsh1236I CGCG 1 cut(s) 519
BsiHKAI GWGCWC 1 cut(s) 177
BsiHKCI CYCGRG 1 cut(s) 311
BsoBI CYCGRG 1 cut(s) 311
Bsp119I TTCGAA 1 cut(s) 258
Bsp1286I GDGCHC 2 cut(s) 177, 312
Bsp143I GATC 1 cut(s) 124
Bsp19I CCATGG 1 cut(s) 377
BspACI CCGC 1 cut(s) 10
BspFNI CGCG 1 cut(s) 519
BspHI TCATGA 1 cut(s) 36
BspLI GGNNCC 2 cut(s) 222, 476
BspT104I TTCGAA 1 cut(s) 258
BssECI CCNNGG 2 cut(s) 224, 377
BssMI GATC 1 cut(s) 124
BssT1I CCWWGG 1 cut(s) 377
Bst2UI CCWGG 2 cut(s) 225, 454
Bst4CI ACNGT 1 cut(s) 235
BstAPI GCANNNNNTGC 1 cut(s) 497
BstBI TTCGAA 1 cut(s) 258
BstDEI CTNAG 2 cut(s) 51, 209
BstDSI CCRYGG 1 cut(s) 377
BstFNI CGCG 1 cut(s) 519
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstMWI GCNNNNNNNGC 1 cut(s) 497
BstNI CCWGG 2 cut(s) 225, 454
BstSCI CCNGG 2 cut(s) 223, 452
BstSLI GKGCMC 1 cut(s) 312
BstUI CGCG 1 cut(s) 519
BstV2I GAAGAC 1 cut(s) 279
BtgI CCRYGG 1 cut(s) 377
CaiI CAGNNNCTG 1 cut(s) 459
CciI TCATGA 1 cut(s) 36
Cfr13I GGNCC 3 cut(s) 132, 381, 474
Csp6I GTAC 3 cut(s) 316, 372, 508
CviAII CATG 4 cut(s) 37, 378, 389, 497
CviJI RGCY 2 cut(s) 175, 305
CviKI_1 RGCY 2 cut(s) 175, 305
CviQI GTAC 3 cut(s) 316, 372, 508
DdeI CTNAG 2 cut(s) 51, 209
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
Ecl136II GAGCTC 1 cut(s) 175
Eco130I CCWWGG 1 cut(s) 377
Eco24I GRGCYC 1 cut(s) 177
Eco47I GGWCC 3 cut(s) 132, 381, 474
Eco53kI GAGCTC 1 cut(s) 175
Eco88I CYCGRG 1 cut(s) 311
EcoICRI GAGCTC 1 cut(s) 175
EcoO109I RGGNCCY 1 cut(s) 474
EcoRII CCWGG 2 cut(s) 223, 452
EcoT14I CCWWGG 1 cut(s) 377
EcoT38I GRGCYC 1 cut(s) 177
ErhI CCWWGG 1 cut(s) 377
FaeI CATG 4 cut(s) 40, 381, 392, 500
FaiI YATR 9 cut(s) 20, 38, 193, 300, 302, 379, 390, 426, 498
FalI AAGNNNNNCTT 4 cut(s) 239, 271, 389, 421
FatI CATG 4 cut(s) 36, 377, 388, 496
FriOI GRGCYC 1 cut(s) 177
FspBI CTAG 2 cut(s) 216, 532
Hin1II CATG 4 cut(s) 40, 381, 392, 500
HinfI GANTC 2 cut(s) 4, 290
Hpy188I TCNGA 2 cut(s) 204, 362
Hpy188III TCNNGA 4 cut(s) 37, 79, 182, 406
HpyAV CCTTC 6 cut(s) 43, 145, 357, 403, 424, 524
HpyCH4III ACNGT 1 cut(s) 235
HpyCH4IV ACGT 1 cut(s) 370
HpyCH4V TGCA 2 cut(s) 239, 491
HpyF10VI GCNNNNNNNGC 1 cut(s) 497
HpyF3I CTNAG 2 cut(s) 51, 209
HpySE526I ACGT 1 cut(s) 370
Hsp92II CATG 4 cut(s) 40, 381, 392, 500
Kzo9I GATC 1 cut(s) 124
LmnI GCTCC 1 cut(s) 444
LpnPI CCDG 7 cut(s) 120, 210, 237, 279, 439, 466, 515
LweI GCATC 1 cut(s) 175
MaeI CTAG 2 cut(s) 216, 532
MaeII ACGT 1 cut(s) 370
MaeIII GTNAC 2 cut(s) 343, 466
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 1 cut(s) 284
MhlI GDGCHC 2 cut(s) 177, 312
MluCI AATT 1 cut(s) 40
MnlI CCTC 3 cut(s) 144, 206, 435
MroXI GAANNNNTTC 2 cut(s) 254, 509
MseI TTAA 2 cut(s) 246, 522
MslI CAYNNNNRTG 1 cut(s) 281
MspR9I CCNGG 2 cut(s) 225, 454
MvaI CCWGG 2 cut(s) 225, 454
MvnI CGCG 1 cut(s) 519
MwoI GCNNNNNNNGC 1 cut(s) 497
NcoI CCATGG 1 cut(s) 377
NdeII GATC 1 cut(s) 124
NlaIII CATG 4 cut(s) 40, 381, 392, 500
NlaIV GGNNCC 2 cut(s) 222, 476
NspV TTCGAA 1 cut(s) 258
PagI TCATGA 1 cut(s) 36
PdmI GAANNNNTTC 2 cut(s) 254, 509
PfeI GAWTC 2 cut(s) 4, 290
PpuMI RGGWCCY 1 cut(s) 474
Psp124BI GAGCTC 1 cut(s) 177
Psp5II RGGWCCY 1 cut(s) 474
Psp6I CCWGG 2 cut(s) 223, 452
PspGI CCWGG 2 cut(s) 223, 452
PspN4I GGNNCC 2 cut(s) 222, 476
PspPI GGNCC 3 cut(s) 132, 381, 474
PspPPI RGGWCCY 1 cut(s) 474
PstNI CAGNNNCTG 1 cut(s) 459
RsaI GTAC 3 cut(s) 317, 373, 509
RsaNI GTAC 3 cut(s) 316, 372, 508
RseI CAYNNNNRTG 1 cut(s) 281
SacI GAGCTC 1 cut(s) 177
SaqAI TTAA 2 cut(s) 246, 522
Sau3AI GATC 1 cut(s) 124
Sau96I GGNCC 3 cut(s) 132, 381, 474
ScaI AGTACT 1 cut(s) 509
ScrFI CCNGG 2 cut(s) 225, 454
SduI GDGCHC 2 cut(s) 177, 312
SfaNI GCATC 1 cut(s) 175
SfuI TTCGAA 1 cut(s) 258
SinI GGWCC 3 cut(s) 132, 381, 474
SmiMI CAYNNNNRTG 1 cut(s) 281
SmlI CTYRAG 1 cut(s) 483
SmoI CTYRAG 1 cut(s) 483
Sse9I AATT 1 cut(s) 40
SsiI CCGC 1 cut(s) 10
SspMI CTAG 2 cut(s) 216, 532
SstI GAGCTC 1 cut(s) 177
StyD4I CCNGG 2 cut(s) 223, 452
StyI CCWWGG 1 cut(s) 377
TaaI ACNGT 1 cut(s) 235
TaiI ACGT 1 cut(s) 373
TaqI TCGA 3 cut(s) 80, 138, 258
TasI AATT 1 cut(s) 40
TatI WGTACW 2 cut(s) 315, 507
TfiI GAWTC 2 cut(s) 4, 290
Tru1I TTAA 2 cut(s) 246, 522
Tru9I TTAA 2 cut(s) 246, 522
TspDTI ATGAA 3 cut(s) 25, 53, 405
VpaK11BI GGWCC 3 cut(s) 132, 381, 474
XapI RAATTY 1 cut(s) 40
XmnI GAANNNNTTC 2 cut(s) 254, 509
XspI CTAG 2 cut(s) 216, 532
ZrmI AGTACT 1 cut(s) 509
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.