Prupe.8G090300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
12342656 .. 12343335
680 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G090300.1

Sequence Viewer

Length: 285 bp
ATGGAAGGTGATAACATGAGAGCCTTTGACATGGGTACACTTAGAACAAATCTTCCACAAAAGAGATCTGGGTTGTCAAGGTACTACTCCGGCAAATCAAGATCATTTACGTGCATGGACGACGTTAGAAGCGTGGAAGATCTTAAGAAACCGGAACATCCCGATGCTAAGAAGAGGAAGAAACATTCAGAGAGGAAGAACTTTCCGGTTCCGACCTACCCTCCTTATCCATGTCGAAGAGTTTCTAGCACCACCCAATGTGCTGCACCTTGTGTTGGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.73

Weight (kDa)

9.73

Isoelectric Point (pI)

59.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015084)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 272
AfaI GTAC 2 cut(s) 37, 83
AfiI CCNNNNNNNGG 1 cut(s) 275
AflII CTTAAG 1 cut(s) 143
AloI GAACNNNNNNTCC 2 cut(s) 37, 69
ApeKI GCWGC 1 cut(s) 263
Asp700I GAANNNNTTC 1 cut(s) 241
AsuHPI GGTGA 1 cut(s) 20
BbvI GCAGC 1 cut(s) 250
BfaI CTAG 1 cut(s) 246
BfrI CTTAAG 1 cut(s) 143
BglII AGATCT 2 cut(s) 65, 139
BisI GCNGC 1 cut(s) 264
BlsI GCNGC 1 cut(s) 265
BmiI GGNNCC 1 cut(s) 210
BmsI GCATC 1 cut(s) 154
BsaAI YACGTR 1 cut(s) 111
BsaWI WCCGGW 2 cut(s) 151, 205
BsaXI ACNNNNNCTCC 2 cut(s) 205, 235
Bsc4I CCNNNNNNNGG 1 cut(s) 275
BseGI GGATG 1 cut(s) 157
BseLI CCNNNNNNNGG 1 cut(s) 275
BseXI GCAGC 1 cut(s) 250
BsgI GTGCAG 1 cut(s) 249
BsiSI CCGG 3 cut(s) 90, 152, 206
BslI CCNNNNNNNGG 1 cut(s) 275
Bsp143I GATC 3 cut(s) 65, 101, 139
BspLI GGNNCC 1 cut(s) 210
BspTI CTTAAG 1 cut(s) 143
BssMI GATC 3 cut(s) 65, 101, 139
Bst6I CTCTTC 2 cut(s) 167, 232
BstAFI CTTAAG 1 cut(s) 143
BstBAI YACGTR 1 cut(s) 111
BstDEI CTNAG 2 cut(s) 41, 168
BstF5I GGATG 1 cut(s) 157
BstKTI GATC 3 cut(s) 68, 104, 142
BstMBI GATC 3 cut(s) 65, 101, 139
BstV1I GCAGC 1 cut(s) 250
BstX2I RGATCY 2 cut(s) 65, 139
BstYI RGATCY 2 cut(s) 65, 139
BtsCI GGATG 1 cut(s) 157
Csp6I GTAC 2 cut(s) 36, 82
CviAII CATG 4 cut(s) 16, 31, 115, 231
CviJI RGCY 1 cut(s) 23
CviKI_1 RGCY 1 cut(s) 23
CviQI GTAC 2 cut(s) 36, 82
DdeI CTNAG 2 cut(s) 41, 168
DpnI GATC 3 cut(s) 67, 103, 141
DpnII GATC 3 cut(s) 65, 101, 139
DraIII CACNNNGTG 1 cut(s) 272
Eam1104I CTCTTC 2 cut(s) 167, 232
EarI CTCTTC 2 cut(s) 167, 232
FaeI CATG 4 cut(s) 19, 34, 118, 234
FaiI YATR 4 cut(s) 17, 32, 116, 232
FatI CATG 4 cut(s) 15, 30, 114, 230
Fnu4HI GCNGC 1 cut(s) 264
FokI GGATG 1 cut(s) 144
Fsp4HI GCNGC 1 cut(s) 264
FspBI CTAG 1 cut(s) 246
GluI GCNGC 1 cut(s) 264
HapII CCGG 3 cut(s) 90, 152, 206
Hin1II CATG 4 cut(s) 19, 34, 118, 234
HpaII CCGG 3 cut(s) 90, 152, 206
HphI GGTGA 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 38
Hpy188I TCNGA 2 cut(s) 190, 213
Hpy188III TCNNGA 2 cut(s) 99, 161
Hpy8I GTNNAC 1 cut(s) 38
Hpy99I CGWCG 1 cut(s) 125
HpyCH4IV ACGT 2 cut(s) 110, 123
HpyCH4V TGCA 2 cut(s) 114, 266
HpyF3I CTNAG 2 cut(s) 41, 168
HpySE526I ACGT 2 cut(s) 110, 123
Hsp92II CATG 4 cut(s) 19, 34, 118, 234
Kzo9I GATC 3 cut(s) 65, 101, 139
LpnPI CCDG 4 cut(s) 54, 103, 165, 219
Lsp1109I GCAGC 1 cut(s) 250
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 246
MaeII ACGT 2 cut(s) 110, 123
MalI GATC 3 cut(s) 67, 103, 141
MboI GATC 3 cut(s) 65, 101, 139
MboII GAAGA 6 cut(s) 44, 149, 184, 190, 208, 249
MflI RGATCY 2 cut(s) 65, 139
MmeI TCCRAC 1 cut(s) 236
MnlI CCTC 3 cut(s) 168, 186, 231
MroXI GAANNNNTTC 1 cut(s) 241
MseI TTAA 1 cut(s) 144
MslI CAYNNNNRTG 2 cut(s) 109, 162
MspCI CTTAAG 1 cut(s) 143
MspI CCGG 3 cut(s) 90, 152, 206
NdeII GATC 3 cut(s) 65, 101, 139
NlaIII CATG 4 cut(s) 19, 34, 118, 234
NlaIV GGNNCC 1 cut(s) 210
PcsI WCGNNNNNNNCGW 1 cut(s) 129
PdmI GAANNNNTTC 1 cut(s) 241
PkrI GCNGC 1 cut(s) 265
Ppu21I YACGTR 1 cut(s) 111
PspN4I GGNNCC 1 cut(s) 210
PsuI RGATCY 2 cut(s) 65, 139
RsaI GTAC 2 cut(s) 37, 83
RsaNI GTAC 2 cut(s) 36, 82
RseI CAYNNNNRTG 2 cut(s) 109, 162
SaqAI TTAA 1 cut(s) 144
SatI GCNGC 1 cut(s) 264
Sau3AI GATC 3 cut(s) 65, 101, 139
SetI ASST 6 cut(s) 10, 83, 113, 126, 218, 271
SfaNI GCATC 1 cut(s) 154
SmiMI CAYNNNNRTG 2 cut(s) 109, 162
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
SspMI CTAG 1 cut(s) 246
TaiI ACGT 2 cut(s) 113, 126
TaqI TCGA 1 cut(s) 235
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TseI GCWGC 1 cut(s) 263
Vha464I CTTAAG 1 cut(s) 143
XmnI GAANNNNTTC 1 cut(s) 241
XspI CTAG 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.