Rmu_sc0000776.1_g000023

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000776.1
Physical Location & Seq
Forward (+)
86268 .. 86760
493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000776.1_g000023.1.cds

Sequence Viewer

Length: 300 bp
atggagatcatggaaggagacaacaacatgagaacattcgacatgggtgcacttaggtcaagtcttccccggaaccagagagggttgtcaaggtactactctggaaaagcacgatcatttacgtgcatggccgatgtccgatgcctagaagatctcaagaaaccagaacgtcccgatgccaaaaagaggaagaaacatactgagaagaagaactttgctgttccagctccctatcctcccattccatgtcgacgagtttctagtaccacccaatttgctacaccctgtgttggtgtgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.27

Weight (kDa)

9.91

Isoelectric Point (pI)

51.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015084)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 250
AcoI YGGCCR 1 cut(s) 129
AdeI CACNNNGTG 1 cut(s) 287
AfaI GTAC 2 cut(s) 95, 265
AfiI CCNNNNNNNGG 2 cut(s) 186, 290
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
Alw21I GWGCWC 1 cut(s) 52
Alw26I GTCTC 1 cut(s) 12
Alw44I GTGCAC 1 cut(s) 48
AoxI GGCC 1 cut(s) 129
ApaLI GTGCAC 1 cut(s) 48
AsuC2I CCSGG 1 cut(s) 70
BaeGI GKGCMC 1 cut(s) 52
BbsI GAAGAC 1 cut(s) 56
Bbv12I GWGCWC 1 cut(s) 52
BcgI CGANNNNNNTGC 2 cut(s) 29, 63
BcnI CCSGG 1 cut(s) 70
BcoDI GTCTC 1 cut(s) 12
BfaI CTAG 2 cut(s) 146, 261
BglII AGATCT 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 70
BmiI GGNNCC 1 cut(s) 74
BmrFI CCNGG 1 cut(s) 70
BmsI GCATC 2 cut(s) 131, 166
BpiI GAAGAC 1 cut(s) 56
BpuEI CTTGAG 1 cut(s) 140
BpuMI CCSGG 1 cut(s) 70
BsaAI YACGTR 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 68
Bsc4I CCNNNNNNNGG 2 cut(s) 186, 290
BseDI CCNNGG 1 cut(s) 68
BseLI CCNNNNNNNGG 2 cut(s) 186, 290
BseMII CTCAG 1 cut(s) 192
BseSI GKGCMC 1 cut(s) 52
BshFI GGCC 1 cut(s) 131
BsiHKAI GWGCWC 1 cut(s) 52
BsiSI CCGG 1 cut(s) 70
BslFI GGGAC 1 cut(s) 156
BslI CCNNNNNNNGG 2 cut(s) 186, 290
BsmAI GTCTC 1 cut(s) 12
BsmFI GGGAC 1 cut(s) 156
BsnI GGCC 1 cut(s) 131
Bsp1286I GDGCHC 1 cut(s) 52
Bsp143I GATC 3 cut(s) 6, 113, 151
BspANI GGCC 1 cut(s) 131
BspCNI CTCAG 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 3 cut(s) 6, 113, 151
BstBAI YACGTR 1 cut(s) 123
BstDEI CTNAG 2 cut(s) 53, 201
BstKTI GATC 3 cut(s) 9, 116, 154
BstMAI GTCTC 1 cut(s) 12
BstMBI GATC 3 cut(s) 6, 113, 151
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstSCI CCNGG 1 cut(s) 68
BstSLI GKGCMC 1 cut(s) 52
BstV2I GAAGAC 1 cut(s) 56
BstX2I RGATCY 1 cut(s) 151
BstYI RGATCY 1 cut(s) 151
BsuRI GGCC 1 cut(s) 131
Csp6I GTAC 2 cut(s) 94, 264
CspCI CAANNNNNGTGG 2 cut(s) 256, 291
CviAII CATG 5 cut(s) 10, 28, 43, 127, 246
CviJI RGCY 2 cut(s) 131, 227
CviKI_1 RGCY 2 cut(s) 131, 227
CviQI GTAC 2 cut(s) 94, 264
DdeI CTNAG 2 cut(s) 53, 201
DpnI GATC 3 cut(s) 8, 115, 153
DpnII GATC 3 cut(s) 6, 113, 151
DraIII CACNNNGTG 1 cut(s) 287
EaeI YGGCCR 1 cut(s) 129
FaeI CATG 5 cut(s) 13, 31, 46, 130, 249
FaiI YATR 6 cut(s) 11, 29, 44, 128, 198, 247
FalI AAGNNNNNCTT 2 cut(s) 197, 229
FaqI GGGAC 1 cut(s) 156
FatI CATG 5 cut(s) 9, 27, 42, 126, 245
FblI GTMKAC 1 cut(s) 250
FspBI CTAG 2 cut(s) 146, 261
HaeIII GGCC 1 cut(s) 131
HapII CCGG 1 cut(s) 70
Hin1II CATG 5 cut(s) 13, 31, 46, 130, 249
HincII GTYRAC 1 cut(s) 251
HindII GTYRAC 1 cut(s) 251
HpaII CCGG 1 cut(s) 70
Hpy166II GTNNAC 2 cut(s) 50, 251
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 3 cut(s) 102, 157, 173
Hpy8I GTNNAC 2 cut(s) 50, 251
Hpy99I CGWCG 1 cut(s) 255
HpyAV CCTTC 1 cut(s) 8
HpyCH4IV ACGT 2 cut(s) 122, 169
HpyCH4V TGCA 2 cut(s) 50, 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpyF3I CTNAG 2 cut(s) 53, 201
HpySE526I ACGT 2 cut(s) 122, 169
Hsp92II CATG 5 cut(s) 13, 31, 46, 130, 249
Kzo9I GATC 3 cut(s) 6, 113, 151
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 5 cut(s) 83, 87, 89, 177, 237
LweI GCATC 2 cut(s) 131, 166
MaeI CTAG 2 cut(s) 146, 261
MaeII ACGT 2 cut(s) 122, 169
MalI GATC 3 cut(s) 8, 115, 153
MboI GATC 3 cut(s) 6, 113, 151
MboII GAAGA 5 cut(s) 56, 161, 202, 217, 220
MflI RGATCY 1 cut(s) 151
MhlI GDGCHC 1 cut(s) 52
MluCI AATT 1 cut(s) 272
MnlI CCTC 3 cut(s) 74, 180, 246
MslI CAYNNNNRTG 1 cut(s) 121
MspI CCGG 1 cut(s) 70
MspR9I CCNGG 1 cut(s) 70
MwoI GCNNNNNNNGC 1 cut(s) 224
NciI CCSGG 1 cut(s) 70
NdeII GATC 3 cut(s) 6, 113, 151
NlaIII CATG 5 cut(s) 13, 31, 46, 130, 249
NlaIV GGNNCC 1 cut(s) 74
Ppu21I YACGTR 1 cut(s) 123
PspN4I GGNNCC 1 cut(s) 74
PsuI RGATCY 1 cut(s) 151
RsaI GTAC 2 cut(s) 95, 265
RsaNI GTAC 2 cut(s) 94, 264
RseI CAYNNNNRTG 1 cut(s) 121
SalI GTCGAC 1 cut(s) 249
Sau3AI GATC 3 cut(s) 6, 113, 151
ScrFI CCNGG 1 cut(s) 70
SduI GDGCHC 1 cut(s) 52
SetI ASST 5 cut(s) 59, 95, 125, 172, 229
SfaNI GCATC 2 cut(s) 131, 166
SmiMI CAYNNNNRTG 1 cut(s) 121
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 1 cut(s) 272
SspMI CTAG 2 cut(s) 146, 261
StyD4I CCNGG 1 cut(s) 68
TaiI ACGT 2 cut(s) 125, 172
TaqI TCGA 2 cut(s) 39, 250
TasI AATT 1 cut(s) 272
VneI GTGCAC 1 cut(s) 48
XmiI GTMKAC 1 cut(s) 250
XspI CTAG 2 cut(s) 146, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.