pycom11g27310

Belongs to the BetVI family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0019285
Physical Location & Seq
Reverse (-)
29606437 .. 29606643
207 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g27310.1

Sequence Viewer

Length: 207 bp
ATGAGTTCCATAAGTTCGAGGCAGGAATTTACAAGTCCAGTGGCAGCAGACAGGTTGTTCAAGGCCTTGATCACAGACTCCGACAATCTCATCCCCAAGCTCATGCCTACGGCCATCAAGAGCATCGAAATCATCCACGGCGACGGCGGCGTAGGAAGCATCAAGCAGATCAACTTTGCTGAGTGTAATTATCAATTAAGCATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bet_v_1

Protein Analysis

69

Amino Acids

7.4

Weight (kDa)

5.59

Isoelectric Point (pI)

58.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 7 - 61 1.4e-09 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019285)

Species Orthologous Gene IDs
malus_domestica MD00G1140400.v1.1
pyrus_communis pycom11g27310 pycom13g13650
rosa_chinensis RchiOBHm_Chr4g0424001 RchiOBHm_Chr7g0212461
rosa_multiflora Rmu_co8041456.1_g000001
rosa_roxburghii Rroxscaffold_5G00354710
rosa_rugosa Rorug04G0192500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 147
AcoI YGGCCR 1 cut(s) 111
AcsI RAATTY 1 cut(s) 26
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
AoxI GGCC 2 cut(s) 63, 111
ApeKI GCWGC 1 cut(s) 44
ApoI RAATTY 1 cut(s) 26
BbvI GCAGC 1 cut(s) 56
BccI CCATC 1 cut(s) 122
BceAI ACGGC 3 cut(s) 126, 154, 160
BclI TGATCA 1 cut(s) 69
BisI GCNGC 2 cut(s) 45, 148
BlsI GCNGC 2 cut(s) 46, 149
BmsI GCATC 2 cut(s) 132, 168
BsaJI CCNNGG 1 cut(s) 136
Bse1I ACTGG 1 cut(s) 38
BseDI CCNNGG 1 cut(s) 136
BseGI GGATG 2 cut(s) 90, 132
BseMII CTCAG 1 cut(s) 171
BseNI ACTGG 1 cut(s) 38
BseXI GCAGC 1 cut(s) 56
BshFI GGCC 2 cut(s) 65, 113
BsnI GGCC 2 cut(s) 65, 113
Bsp143I GATC 2 cut(s) 69, 168
BspACI CCGC 1 cut(s) 147
BspANI GGCC 2 cut(s) 65, 113
BspCNI CTCAG 1 cut(s) 172
BsrI ACTGG 1 cut(s) 38
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 2 cut(s) 69, 168
BstDEI CTNAG 1 cut(s) 180
BstDSI CCRYGG 1 cut(s) 136
BstF5I GGATG 2 cut(s) 90, 132
BstKTI GATC 2 cut(s) 72, 171
BstMBI GATC 2 cut(s) 69, 168
BstMWI GCNNNNNNNGC 2 cut(s) 147, 156
BstNSI RCATGY 1 cut(s) 205
BstV1I GCAGC 1 cut(s) 56
BsuRI GGCC 2 cut(s) 65, 113
BtgI CCRYGG 1 cut(s) 136
BtsCI GGATG 2 cut(s) 90, 132
BtsIMutI CAGTG 1 cut(s) 45
CspCI CAANNNNNGTGG 2 cut(s) 21, 56
CviAII CATG 2 cut(s) 103, 202
CviJI RGCY 3 cut(s) 65, 100, 113
CviKI_1 RGCY 3 cut(s) 65, 100, 113
DdeI CTNAG 1 cut(s) 180
DpnI GATC 2 cut(s) 71, 170
DpnII GATC 2 cut(s) 69, 168
EaeI YGGCCR 1 cut(s) 111
Eco147I AGGCCT 1 cut(s) 65
FaeI CATG 2 cut(s) 106, 205
FaiI YATR 3 cut(s) 11, 104, 203
FatI CATG 2 cut(s) 102, 201
FbaI TGATCA 1 cut(s) 69
Fnu4HI GCNGC 2 cut(s) 45, 148
FokI GGATG 2 cut(s) 77, 119
Fsp4HI GCNGC 2 cut(s) 45, 148
GluI GCNGC 2 cut(s) 45, 148
HaeIII GGCC 2 cut(s) 65, 113
Hin1II CATG 2 cut(s) 106, 205
HinfI GANTC 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 118
Hpy99I CGWCG 1 cut(s) 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 147, 156
HpyF3I CTNAG 1 cut(s) 180
Hsp92II CATG 2 cut(s) 106, 205
Ksp22I TGATCA 1 cut(s) 69
Kzo9I GATC 2 cut(s) 69, 168
LpnPI CCDG 3 cut(s) 8, 37, 51
Lsp1109I GCAGC 1 cut(s) 56
LweI GCATC 2 cut(s) 132, 168
MalI GATC 2 cut(s) 71, 170
MboI GATC 2 cut(s) 69, 168
MluCI AATT 3 cut(s) 26, 187, 194
MlyI GAGTC 1 cut(s) 71
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 1 cut(s) 12
MseI TTAA 1 cut(s) 197
MwoI GCNNNNNNNGC 2 cut(s) 147, 156
NdeII GATC 2 cut(s) 69, 168
NlaIII CATG 2 cut(s) 106, 205
NspI RCATGY 1 cut(s) 205
PceI AGGCCT 1 cut(s) 65
PkrI GCNGC 2 cut(s) 46, 149
PleI GAGTC 1 cut(s) 71
PpsI GAGTC 1 cut(s) 71
SaqAI TTAA 1 cut(s) 197
SatI GCNGC 2 cut(s) 45, 148
Sau3AI GATC 2 cut(s) 69, 168
SchI GAGTC 1 cut(s) 71
SetI ASST 2 cut(s) 56, 102
SfaNI GCATC 2 cut(s) 132, 168
Sse9I AATT 3 cut(s) 26, 187, 194
SseBI AGGCCT 1 cut(s) 65
SsiI CCGC 1 cut(s) 147
StuI AGGCCT 1 cut(s) 65
TaqI TCGA 2 cut(s) 17, 126
TasI AATT 3 cut(s) 26, 187, 194
TauI GCSGC 1 cut(s) 150
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TscAI CASTG 1 cut(s) 45
TseI GCWGC 1 cut(s) 44
TspRI CASTG 1 cut(s) 45
XapI RAATTY 1 cut(s) 26
XceI RCATGY 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.