RchiOBHm_Chr7g0212461

Major allergen Pru

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
29725872 .. 29726054
183 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19011

Sequence Viewer

Length: 183 bp
ATGAGTGTTTTCACTTATGAAACTGAGTTCAGCTCTGTCATTCCTCCTGCTAGGTTGTTCAAAGCCTTTGTTCTTGATGCCGACAACCTCATCCCGAAGATTGCTCCCCAAGCAGTTAAGAGTGCTGAGAAACTCTTGAGGAGATGGAGTTGGAACCGTCAAGAAGAGCAGCTTTGTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

7.01

Weight (kDa)

7.92

Isoelectric Point (pI)

71.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019285)

Species Orthologous Gene IDs
malus_domestica MD00G1140400.v1.1
pyrus_communis pycom11g27310 pycom13g13650
rosa_chinensis RchiOBHm_Chr4g0424001 RchiOBHm_Chr7g0212461
rosa_multiflora Rmu_co8041456.1_g000001
rosa_roxburghii Rroxscaffold_5G00354710
rosa_rugosa Rorug04G0192500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 2 cut(s) 33, 172
AluI AGCT 2 cut(s) 33, 172
ApeKI GCWGC 1 cut(s) 169
BccI CCATC 1 cut(s) 138
BfaI CTAG 2 cut(s) 51, 181
BisI GCNGC 1 cut(s) 170
BlsI GCNGC 1 cut(s) 171
BmiI GGNNCC 1 cut(s) 155
BmsI GCATC 1 cut(s) 67
BplI GAGNNNNNCTC 2 cut(s) 17, 49
BpuEI CTTGAG 1 cut(s) 157
BsaXI ACNNNNNCTCC 2 cut(s) 133, 163
BseGI GGATG 1 cut(s) 90
BseMII CTCAG 2 cut(s) 15, 117
BseRI GAGGAG 1 cut(s) 154
BspCNI CTCAG 2 cut(s) 16, 118
BspLI GGNNCC 1 cut(s) 155
BspQI GCTCTTC 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 158
Bst6I CTCTTC 1 cut(s) 159
BstDEI CTNAG 2 cut(s) 24, 126
BstF5I GGATG 1 cut(s) 90
BstMWI GCNNNNNNNGC 1 cut(s) 110
BtsCI GGATG 1 cut(s) 90
CviJI RGCY 3 cut(s) 33, 65, 172
CviKI_1 RGCY 3 cut(s) 33, 65, 172
DdeI CTNAG 2 cut(s) 24, 126
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
FaiI YATR 1 cut(s) 18
FalI AAGNNNNNCTT 1 cut(s) 156
Fnu4HI GCNGC 1 cut(s) 170
FokI GGATG 1 cut(s) 77
Fsp4HI GCNGC 1 cut(s) 170
FspBI CTAG 2 cut(s) 51, 181
GluI GCNGC 1 cut(s) 170
Hpy188III TCNNGA 4 cut(s) 74, 94, 136, 161
HpyCH4III ACNGT 1 cut(s) 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
HpyF3I CTNAG 2 cut(s) 24, 126
LguI GCTCTTC 1 cut(s) 159
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 1 cut(s) 60
LweI GCATC 1 cut(s) 67
MaeI CTAG 2 cut(s) 51, 181
MaeIII GTNAC 1 cut(s) 176
MboII GAAGA 2 cut(s) 109, 176
MmeI TCCRAC 1 cut(s) 131
MnlI CCTC 3 cut(s) 54, 98, 132
MseI TTAA 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 110
NlaIV GGNNCC 1 cut(s) 155
NmuCI GTSAC 1 cut(s) 176
PciSI GCTCTTC 1 cut(s) 159
PkrI GCNGC 1 cut(s) 171
PspN4I GGNNCC 1 cut(s) 155
SapI GCTCTTC 1 cut(s) 159
SaqAI TTAA 1 cut(s) 117
SatI GCNGC 1 cut(s) 170
SetI ASST 4 cut(s) 35, 56, 90, 174
SfaNI GCATC 1 cut(s) 67
SgeI CNNG 7 cut(s) 59, 63, 86, 106, 122, 148, 173
SmlI CTYRAG 1 cut(s) 136
SmoI CTYRAG 1 cut(s) 136
SspMI CTAG 2 cut(s) 51, 181
TaaI ACNGT 1 cut(s) 158
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TseFI GTSAC 1 cut(s) 176
TseI GCWGC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 176
TspDTI ATGAA 1 cut(s) 33
XspI CTAG 2 cut(s) 51, 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.