Rroxscaffold_5G00354710

Major allergen Pru

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
33222594 .. 33224771
2178 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00354710.1

Sequence Viewer

Length: 195 bp
ATGGGTGTCTTCACTTATGAATCTGAGTTCAACTCTGTCATTCCACCAGCTAGGTTGTTCAAGGCCTTTGTCCTTGACGCCGACAACCTCATCCCCAAGATTGCTCCCCAAGCAGTTAATGCAAGCGGCAAGCCTCCAATTTGTGGAATATCAGGATGTAGAAATAGAAACAACTTCCGAAACGAGGAGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.04

Weight (kDa)

7.79

Isoelectric Point (pI)

28.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019285)

Species Orthologous Gene IDs
malus_domestica MD00G1140400.v1.1
pyrus_communis pycom11g27310 pycom13g13650
rosa_chinensis RchiOBHm_Chr4g0424001 RchiOBHm_Chr7g0212461
rosa_multiflora Rmu_co8041456.1_g000001
rosa_roxburghii Rroxscaffold_5G00354710
rosa_rugosa Rorug04G0192500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 143
AciI CCGC 1 cut(s) 126
AcyI GRCGYC 1 cut(s) 78
AfiI CCNNNNNNNGG 2 cut(s) 143, 184
AgsI TTSAA 2 cut(s) 31, 61
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
AoxI GGCC 1 cut(s) 63
BfaI CTAG 1 cut(s) 51
BisI GCNGC 1 cut(s) 127
BlsI GCNGC 1 cut(s) 128
BplI GAGNNNNNCTC 2 cut(s) 17, 49
BsaHI GRCGYC 1 cut(s) 78
Bsc4I CCNNNNNNNGG 2 cut(s) 143, 184
BseGI GGATG 2 cut(s) 90, 161
BseLI CCNNNNNNNGG 2 cut(s) 143, 184
BseMII CTCAG 1 cut(s) 15
BshFI GGCC 1 cut(s) 65
BslI CCNNNNNNNGG 2 cut(s) 143, 184
BsnI GGCC 1 cut(s) 65
BspACI CCGC 1 cut(s) 126
BspANI GGCC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 16
BssNI GRCGYC 1 cut(s) 78
BstACI GRCGYC 1 cut(s) 78
BstAPI GCANNNNNTGC 1 cut(s) 119
BstC8I GCNNGC 2 cut(s) 124, 131
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 2 cut(s) 90, 161
BstMWI GCNNNNNNNGC 2 cut(s) 110, 119
BsuRI GGCC 1 cut(s) 65
BtsCI GGATG 2 cut(s) 90, 161
Cac8I GCNNGC 2 cut(s) 124, 131
CseI GACGC 1 cut(s) 86
CviJI RGCY 3 cut(s) 50, 65, 133
CviKI_1 RGCY 3 cut(s) 50, 65, 133
DdeI CTNAG 1 cut(s) 24
Eco147I AGGCCT 1 cut(s) 65
FaiI YATR 1 cut(s) 18
Fnu4HI GCNGC 1 cut(s) 127
FokI GGATG 2 cut(s) 77, 168
Fsp4HI GCNGC 1 cut(s) 127
FspBI CTAG 1 cut(s) 51
GluI GCNGC 1 cut(s) 127
HaeIII GGCC 1 cut(s) 65
HgaI GACGC 1 cut(s) 86
Hin1I GRCGYC 1 cut(s) 78
HinfI GANTC 1 cut(s) 20
Hpy188I TCNGA 2 cut(s) 25, 179
Hpy188III TCNNGA 1 cut(s) 153
HpyCH4V TGCA 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 2 cut(s) 110, 119
HpyF3I CTNAG 1 cut(s) 24
Hsp92I GRCGYC 1 cut(s) 78
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 2 cut(s) 60, 138
MaeI CTAG 1 cut(s) 51
MluCI AATT 1 cut(s) 138
MnlI CCTC 3 cut(s) 98, 144, 178
MseI TTAA 1 cut(s) 117
MwoI GCNNNNNNNGC 2 cut(s) 110, 119
PceI AGGCCT 1 cut(s) 65
PfeI GAWTC 1 cut(s) 20
PflMI CCANNNNNTGG 1 cut(s) 143
PkrI GCNGC 1 cut(s) 128
SaqAI TTAA 1 cut(s) 117
SatI GCNGC 1 cut(s) 127
SetI ASST 3 cut(s) 52, 56, 90
SgeI CNNG 9 cut(s) 59, 63, 73, 86, 109, 122, 135, 142, 165
Sse9I AATT 1 cut(s) 138
SseBI AGGCCT 1 cut(s) 65
SsiI CCGC 1 cut(s) 126
SspMI CTAG 1 cut(s) 51
StuI AGGCCT 1 cut(s) 65
TasI AATT 1 cut(s) 138
TauI GCSGC 1 cut(s) 129
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 1 cut(s) 33
Van91I CCANNNNNTGG 1 cut(s) 143
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.