pycom12g01710

Transcriptional activator

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
1433402 .. 1436425
3024 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGAAACGAAAATTTTTGCCATTAATCTTTAGTGAGCTTGAAGGGCTCTTAGATCCGATGAGGAAGGATGTTTCACAAGTTCGTAAGAAGATCAATGGGATTAACAAAGAGTTAAAGTCACTAGGACATACCTGCCAGAAGAAGGAAAAGGAATACAGAGATGCACTTGAGGCTTTCAATGAAAAGAACAGAGAAAAAGTGCAGCTTATCACAAAGCTAATGGAGGTTAGTTTGTCACAGGAAAGGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.83

Weight (kDa)

9.48

Isoelectric Point (pI)

14.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transcrip_act PF04949 4 - 81 1.4e-33 Transcriptional activator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 140
AclWI GGATC 1 cut(s) 47
AcsI RAATTY 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 142
AgsI TTSAA 2 cut(s) 41, 178
AluBI AGCT 3 cut(s) 37, 205, 217
AluI AGCT 3 cut(s) 37, 205, 217
AlwI GGATC 1 cut(s) 47
ApeKI GCWGC 1 cut(s) 202
ApoI RAATTY 1 cut(s) 11
AseI ATTAAT 1 cut(s) 23
BanII GRGCYC 1 cut(s) 48
BbvI GCAGC 1 cut(s) 214
BfaI CTAG 1 cut(s) 122
BfuAI ACCTGC 1 cut(s) 140
BisI GCNGC 1 cut(s) 203
BlsI GCNGC 1 cut(s) 204
BmsI GCATC 1 cut(s) 151
BpuEI CTTGAG 1 cut(s) 188
Bsc4I CCNNNNNNNGG 1 cut(s) 142
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 142
BseXI GCAGC 1 cut(s) 214
BsgI GTGCAG 1 cut(s) 221
BslI CCNNNNNNNGG 1 cut(s) 142
Bsp1286I GDGCHC 1 cut(s) 48
Bsp143I GATC 2 cut(s) 52, 90
BspMI ACCTGC 1 cut(s) 140
BspPI GGATC 1 cut(s) 47
BssMI GATC 2 cut(s) 52, 90
BstDEI CTNAG 1 cut(s) 49
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 2 cut(s) 55, 93
BstMBI GATC 2 cut(s) 52, 90
BstMWI GCNNNNNNNGC 2 cut(s) 43, 170
BstV1I GCAGC 1 cut(s) 214
BstX2I RGATCY 1 cut(s) 52
BstYI RGATCY 1 cut(s) 52
BtsCI GGATG 1 cut(s) 73
BveI ACCTGC 1 cut(s) 140
CviJI RGCY 5 cut(s) 37, 46, 173, 205, 217
CviKI_1 RGCY 5 cut(s) 37, 46, 173, 205, 217
DdeI CTNAG 1 cut(s) 49
DpnI GATC 2 cut(s) 54, 92
DpnII GATC 2 cut(s) 52, 90
Eco24I GRGCYC 1 cut(s) 48
EcoT38I GRGCYC 1 cut(s) 48
FaiI YATR 1 cut(s) 129
FalI AAGNNNNNCTT 2 cut(s) 189, 221
Fnu4HI GCNGC 1 cut(s) 203
FokI GGATG 1 cut(s) 80
FriOI GRGCYC 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 203
FspBI CTAG 1 cut(s) 122
GluI GCNGC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 57
HpyAV CCTTC 3 cut(s) 35, 58, 136
HpyCH4V TGCA 2 cut(s) 164, 202
HpyF10VI GCNNNNNNNGC 2 cut(s) 43, 170
HpyF3I CTNAG 1 cut(s) 49
Kzo9I GATC 2 cut(s) 52, 90
LpnPI CCDG 3 cut(s) 145, 149, 224
Lsp1109I GCAGC 1 cut(s) 214
LweI GCATC 1 cut(s) 151
MaeI CTAG 1 cut(s) 122
MaeIII GTNAC 2 cut(s) 117, 234
MalI GATC 2 cut(s) 54, 92
MboI GATC 2 cut(s) 52, 90
MboII GAAGA 2 cut(s) 100, 151
MflI RGATCY 1 cut(s) 52
MhlI GDGCHC 1 cut(s) 48
MluCI AATT 1 cut(s) 11
MnlI CCTC 3 cut(s) 54, 163, 217
MseI TTAA 3 cut(s) 23, 102, 113
MwoI GCNNNNNNNGC 2 cut(s) 43, 170
NdeII GATC 2 cut(s) 52, 90
NmuCI GTSAC 2 cut(s) 117, 234
PkrI GCNGC 1 cut(s) 204
PshBI ATTAAT 1 cut(s) 23
PsuI RGATCY 1 cut(s) 52
SaqAI TTAA 3 cut(s) 23, 102, 113
SatI GCNGC 1 cut(s) 203
Sau3AI GATC 2 cut(s) 52, 90
SduI GDGCHC 1 cut(s) 48
SetI ASST 5 cut(s) 39, 134, 207, 219, 228
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 6 cut(s) 50, 89, 134, 144, 148, 179
SmlI CTYRAG 1 cut(s) 167
SmoI CTYRAG 1 cut(s) 167
Sse9I AATT 1 cut(s) 11
SspMI CTAG 1 cut(s) 122
TasI AATT 1 cut(s) 11
Tru1I TTAA 3 cut(s) 23, 102, 113
Tru9I TTAA 3 cut(s) 23, 102, 113
TseFI GTSAC 2 cut(s) 117, 234
TseI GCWGC 1 cut(s) 202
Tsp45I GTSAC 2 cut(s) 117, 234
TspDTI ATGAA 2 cut(s) 17, 195
VspI ATTAAT 1 cut(s) 23
XapI RAATTY 1 cut(s) 11
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.