pycom12g01850

regulation of response to stimulus

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
1537430 .. 1542489
5060 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g01850.12

Sequence Viewer

Length: 264 bp
ATGCCATTAACAAAGAGAAAAGGAGATGCACTTGAGTTTTTCAATGAAAAGAAGAGAGAAAAAGTGCAGCTTATCACGAAGCTAATGGAGGTGTTGGAGAGTGTAAATAAGATGATAATAAGAGGATGGTGGAGTTCGGCTAAATCAGACAATGGGGTCATTAACAAGTGTAGGCTTCATAAGTTGATAATCTTTTGGAAGATCGGATATCATATGTCTGAGTATACTTCATATAATAGCTATGTGATGATGACAAACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.38

Weight (kDa)

9.79

Isoelectric Point (pI)

39.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 155
AccI GTMKAC 1 cut(s) 224
AgsI TTSAA 1 cut(s) 43
AluBI AGCT 3 cut(s) 70, 82, 240
AluI AGCT 3 cut(s) 70, 82, 240
ApeKI GCWGC 1 cut(s) 67
BbvI GCAGC 1 cut(s) 79
BccI CCATC 1 cut(s) 120
BisI GCNGC 1 cut(s) 68
BlsI GCNGC 1 cut(s) 69
BmsI GCATC 1 cut(s) 16
BpuEI CTTGAG 1 cut(s) 53
BseGI GGATG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 210
BseXI GCAGC 1 cut(s) 79
BsgI GTGCAG 1 cut(s) 86
Bsp143I GATC 1 cut(s) 201
BspCNI CTCAG 1 cut(s) 211
BssMI GATC 1 cut(s) 201
BssNAI GTATAC 1 cut(s) 225
Bst1107I GTATAC 1 cut(s) 225
Bst6I CTCTTC 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 219
BstF5I GGATG 1 cut(s) 131
BstKTI GATC 1 cut(s) 204
BstMBI GATC 1 cut(s) 201
BstV1I GCAGC 1 cut(s) 79
BstZ17I GTATAC 1 cut(s) 225
BtsCI GGATG 1 cut(s) 131
CviJI RGCY 5 cut(s) 70, 82, 140, 175, 240
CviKI_1 RGCY 5 cut(s) 70, 82, 140, 175, 240
DdeI CTNAG 1 cut(s) 219
DpnI GATC 1 cut(s) 203
DpnII GATC 1 cut(s) 201
DrdI GACNNNNNNGTC 1 cut(s) 155
DseDI GACNNNNNNGTC 1 cut(s) 155
Eam1104I CTCTTC 1 cut(s) 47
EarI CTCTTC 1 cut(s) 47
Eco32I GATATC 1 cut(s) 209
EcoRV GATATC 1 cut(s) 209
FaiI YATR 7 cut(s) 180, 213, 215, 225, 232, 234, 243
FalI AAGNNNNNCTT 2 cut(s) 54, 86
FauNDI CATATG 1 cut(s) 213
FblI GTMKAC 1 cut(s) 224
Fnu4HI GCNGC 1 cut(s) 68
FokI GGATG 1 cut(s) 138
Fsp4HI GCNGC 1 cut(s) 68
GluI GCNGC 1 cut(s) 68
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 3 cut(s) 148, 206, 220
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 225
HpyCH4V TGCA 2 cut(s) 29, 67
HpyF3I CTNAG 1 cut(s) 219
Kzo9I GATC 1 cut(s) 201
Lsp1109I GCAGC 1 cut(s) 79
LweI GCATC 1 cut(s) 16
MalI GATC 1 cut(s) 203
MboI GATC 1 cut(s) 201
MboII GAAGA 2 cut(s) 64, 211
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 2 cut(s) 82, 116
MseI TTAA 2 cut(s) 8, 162
NdeI CATATG 1 cut(s) 213
NdeII GATC 1 cut(s) 201
PkrI GCNGC 1 cut(s) 69
SaqAI TTAA 2 cut(s) 8, 162
SatI GCNGC 1 cut(s) 68
Sau3AI GATC 1 cut(s) 201
SetI ASST 4 cut(s) 72, 84, 93, 242
SfaNI GCATC 1 cut(s) 16
SgeI CNNG 3 cut(s) 44, 88, 178
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Tru1I TTAA 2 cut(s) 8, 162
Tru9I TTAA 2 cut(s) 8, 162
TseI GCWGC 1 cut(s) 67
TspDTI ATGAA 3 cut(s) 60, 167, 219
XmiI GTMKAC 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.