pycom12g15790

Mitochondrial inner membrane protease subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
18231183 .. 18231605
423 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGGGAACTCGGAGTGGTTTGTGGAATTTTGCCAACAAGTTTTTCACATGTGGGATTATAGGTGTATATGTTTCGGATCGATTTGCGAGTGTTGCTCCGGTGCGGGGTTCCTCTATGTCGCCTACGTTAAACCCTGGAACGAGTTCTTTGATGGGCTTGCCAACTGATGACTATGTCTTGGTCGACAAACGGTGTCTTCAAAACTACAAGTTCTCACATGGTGACGTGGTAGTTTTCCGCTCCCCAAGTAACCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.31

Weight (kDa)

9.18

Isoelectric Point (pI)

54.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011438)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 240
AccI GTMKAC 1 cut(s) 183
AciI CCGC 2 cut(s) 103, 238
AclWI GGATC 1 cut(s) 84
AcsI RAATTY 1 cut(s) 25
AdeI CACNNNGTG 1 cut(s) 221
AfiI CCNNNNNNNGG 1 cut(s) 104
AflIII ACRYGT 1 cut(s) 47
AgsI TTSAA 1 cut(s) 200
AjiI CACGTC 1 cut(s) 226
AjnI CCWGG 1 cut(s) 133
AjuI GAANNNNNNNTTGG 2 cut(s) 26, 58
AlwI GGATC 1 cut(s) 84
ApoI RAATTY 1 cut(s) 25
Asp700I GAANNNNTTC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 233
BbsI GAAGAC 1 cut(s) 188
BccI CCATC 1 cut(s) 145
BciT130I CCWGG 1 cut(s) 135
BfaI CTAG 1 cut(s) 256
Bme1390I CCNGG 1 cut(s) 135
BmgBI CACGTC 1 cut(s) 226
BmiI GGNNCC 1 cut(s) 109
BmrFI CCNGG 1 cut(s) 135
BpiI GAAGAC 1 cut(s) 188
BplI GAGNNNNNCTC 2 cut(s) 79, 111
Bsa29I ATCGAT 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 133
BsaWI WCCGGW 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 104
BseBI CCWGG 1 cut(s) 135
BseCI ATCGAT 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 104
BshVI ATCGAT 1 cut(s) 79
BsiSI CCGG 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 104
Bsp143I GATC 1 cut(s) 76
BspACI CCGC 2 cut(s) 103, 238
BspDI ATCGAT 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 109
BspPI GGATC 1 cut(s) 84
BsrBI CCGCTC 1 cut(s) 240
BssECI CCNNGG 1 cut(s) 133
BssMI GATC 1 cut(s) 76
Bst2UI CCWGG 1 cut(s) 135
Bst4CI ACNGT 1 cut(s) 192
BstC8I GCNNGC 1 cut(s) 158
BstKTI GATC 1 cut(s) 79
BstMBI GATC 1 cut(s) 76
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 135
BstNSI RCATGY 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 133
BstV2I GAAGAC 1 cut(s) 188
Bsu15I ATCGAT 1 cut(s) 79
BsuTUI ATCGAT 1 cut(s) 79
BtrI CACGTC 1 cut(s) 226
Cac8I GCNNGC 1 cut(s) 158
ClaI ATCGAT 1 cut(s) 79
CviAII CATG 2 cut(s) 48, 218
CviJI RGCY 1 cut(s) 156
CviKI_1 RGCY 1 cut(s) 156
DpnI GATC 1 cut(s) 78
DpnII GATC 1 cut(s) 76
DraIII CACNNNGTG 1 cut(s) 221
EcoRII CCWGG 1 cut(s) 133
FaeI CATG 2 cut(s) 51, 221
FaiI YATR 7 cut(s) 49, 59, 67, 69, 116, 174, 219
FatI CATG 2 cut(s) 47, 217
FauI CCCGC 1 cut(s) 96
FblI GTMKAC 1 cut(s) 183
FspBI CTAG 1 cut(s) 256
HapII CCGG 1 cut(s) 98
Hin1II CATG 2 cut(s) 51, 221
HincII GTYRAC 1 cut(s) 184
HindII GTYRAC 1 cut(s) 184
HpaII CCGG 1 cut(s) 98
HphI GGTGA 1 cut(s) 233
Hpy166II GTNNAC 1 cut(s) 184
Hpy188I TCNGA 2 cut(s) 12, 76
Hpy8I GTNNAC 1 cut(s) 184
HpyCH4III ACNGT 1 cut(s) 192
HpyCH4IV ACGT 2 cut(s) 125, 225
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpySE526I ACGT 2 cut(s) 125, 225
Hsp92II CATG 2 cut(s) 51, 221
Kzo9I GATC 1 cut(s) 76
LmnI GCTCC 2 cut(s) 100, 245
LpnPI CCDG 3 cut(s) 111, 120, 147
MaeI CTAG 1 cut(s) 256
MaeII ACGT 2 cut(s) 125, 225
MaeIII GTNAC 2 cut(s) 221, 248
MalI GATC 1 cut(s) 78
MbiI CCGCTC 1 cut(s) 240
MboI GATC 1 cut(s) 76
MboII GAAGA 1 cut(s) 188
MluCI AATT 1 cut(s) 25
MnlI CCTC 1 cut(s) 121
MroXI GAANNNNTTC 1 cut(s) 142
MseI TTAA 1 cut(s) 128
MspI CCGG 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 135
MvaI CCWGG 1 cut(s) 135
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 1 cut(s) 76
NlaIII CATG 2 cut(s) 51, 221
NlaIV GGNNCC 1 cut(s) 109
NmuCI GTSAC 1 cut(s) 221
NspI RCATGY 1 cut(s) 51
PciI ACATGT 1 cut(s) 47
PdmI GAANNNNTTC 1 cut(s) 142
PflFI GACNNNGTC 1 cut(s) 173
PscI ACATGT 1 cut(s) 47
Psp6I CCWGG 1 cut(s) 133
PspGI CCWGG 1 cut(s) 133
PspN4I GGNNCC 1 cut(s) 109
PsyI GACNNNGTC 1 cut(s) 173
SalI GTCGAC 1 cut(s) 182
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 1 cut(s) 76
ScrFI CCNGG 1 cut(s) 135
SetI ASST 3 cut(s) 64, 128, 228
Sse9I AATT 1 cut(s) 25
SsiI CCGC 2 cut(s) 103, 238
SspMI CTAG 1 cut(s) 256
StyD4I CCNGG 1 cut(s) 133
TaaI ACNGT 1 cut(s) 192
TaiI ACGT 2 cut(s) 128, 228
TaqI TCGA 2 cut(s) 79, 183
TasI AATT 1 cut(s) 25
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TseFI GTSAC 1 cut(s) 221
Tsp45I GTSAC 1 cut(s) 221
Tth111I GACNNNGTC 1 cut(s) 173
XapI RAATTY 1 cut(s) 25
XceI RCATGY 1 cut(s) 51
XmiI GTMKAC 1 cut(s) 183
XmnI GAANNNNTTC 1 cut(s) 142
XspI CTAG 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.