pycom12g24230

Introduction of a cis double bond between carbons of the acyl chain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0020446
Physical Location & Seq
Forward (+)
24570655 .. 24570975
321 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g24230.1

Sequence Viewer

Length: 321 bp
ATGATGAAGAAAAAGATATCAATGCCTGCCCACTTGATGTACGATGGTCAGGATGATAATCTGTTTGATCATTTCTCAGCTGTTGCCCAGAGGCTTGAGGTGTATACTGCCAGGGATTATGCTGATATATTGGAGTTTTTGGTTGGAAGATGGAATGTGGAGAAGTTGACTGGTCTTTCTGGTGAGGGACGCAAGGCGCAAGATTTTGTGTGTAAATTGCCACAGAGAATCAGGAGGTTGGAGGAAAGAGCACAGGGAAGGACCAAGGCTTCATCCCTTGTTCCATTCAGCTGGATTTTTGGTAGGGAAGTAAAGGTTTAA

Protein Analysis

107

Amino Acids

12.29

Weight (kDa)

9.41

Isoelectric Point (pI)

42.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FA_desaturase_2 PF03405 1 - 100 1.4e-39 Fatty acid desaturase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020446)

Species Orthologous Gene IDs
pyrus_communis pycom12g24230
rosa_multiflora Rmu_co8293057.1_g000001 Rmu_co8451205.1_g000001 Rmu_sc0016148.1_g000002 Rmu_ssc0000473.1_g000018
rosa_roxburghii Rroxscaffold_2G00120150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 104
AfaI GTAC 1 cut(s) 41
AjnI CCWGG 1 cut(s) 110
AluBI AGCT 2 cut(s) 80, 291
AluI AGCT 2 cut(s) 80, 291
Alw21I GWGCWC 1 cut(s) 253
AspLEI GCGC 1 cut(s) 199
AspS9I GGNCC 1 cut(s) 261
AsuHPI GGTGA 1 cut(s) 194
AvaII GGWCC 1 cut(s) 261
Bbv12I GWGCWC 1 cut(s) 253
BccI CCATC 2 cut(s) 38, 144
BciT130I CCWGG 1 cut(s) 112
BclI TGATCA 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 261
BmgT120I GGNCC 1 cut(s) 261
BmrFI CCNGG 1 cut(s) 112
BpuEI CTTGAG 1 cut(s) 116
BsaBI GATNNNNATC 1 cut(s) 57
BsaJI CCNNGG 2 cut(s) 111, 264
Bse1I ACTGG 1 cut(s) 175
Bse8I GATNNNNATC 1 cut(s) 57
BseBI CCWGG 1 cut(s) 112
BseDI CCNNGG 2 cut(s) 111, 264
BseGI GGATG 2 cut(s) 58, 272
BseJI GATNNNNATC 1 cut(s) 57
BseMII CTCAG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 175
BsiHKAI GWGCWC 1 cut(s) 253
BslFI GGGAC 1 cut(s) 201
BsmFI GGGAC 1 cut(s) 201
Bsp1286I GDGCHC 1 cut(s) 253
Bsp143I GATC 1 cut(s) 67
BspCNI CTCAG 1 cut(s) 89
BsrI ACTGG 1 cut(s) 175
BssECI CCNNGG 2 cut(s) 111, 264
BssMI GATC 1 cut(s) 67
BssNAI GTATAC 1 cut(s) 105
BssT1I CCWWGG 1 cut(s) 264
Bst1107I GTATAC 1 cut(s) 105
Bst2UI CCWGG 1 cut(s) 112
BstC8I GCNNGC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 76
BstF5I GGATG 2 cut(s) 58, 272
BstHHI GCGC 1 cut(s) 199
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstNI CCWGG 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 110
BstXI CCANNNNNNTGG 1 cut(s) 291
BstZ17I GTATAC 1 cut(s) 105
BtsCI GGATG 2 cut(s) 58, 272
Cac8I GCNNGC 1 cut(s) 27
CfoI GCGC 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 261
CseI GACGC 1 cut(s) 198
Csp6I GTAC 1 cut(s) 40
CviJI RGCY 4 cut(s) 80, 94, 269, 291
CviKI_1 RGCY 4 cut(s) 80, 94, 269, 291
CviQI GTAC 1 cut(s) 40
DdeI CTNAG 1 cut(s) 76
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Eco130I CCWWGG 1 cut(s) 264
Eco32I GATATC 1 cut(s) 18
Eco47I GGWCC 1 cut(s) 261
EcoRII CCWGG 1 cut(s) 110
EcoRV GATATC 1 cut(s) 18
EcoT14I CCWWGG 1 cut(s) 264
ErhI CCWWGG 1 cut(s) 264
FaiI YATR 3 cut(s) 105, 120, 128
FaqI GGGAC 1 cut(s) 201
FbaI TGATCA 1 cut(s) 67
FblI GTMKAC 1 cut(s) 104
FokI GGATG 2 cut(s) 65, 259
GlaI GCGC 1 cut(s) 198
HgaI GACGC 1 cut(s) 198
HhaI GCGC 1 cut(s) 199
Hin6I GCGC 1 cut(s) 197
HinP1I GCGC 1 cut(s) 197
HincII GTYRAC 1 cut(s) 168
HindII GTYRAC 1 cut(s) 168
HinfI GANTC 1 cut(s) 228
HphI GGTGA 1 cut(s) 194
Hpy166II GTNNAC 2 cut(s) 105, 168
Hpy188III TCNNGA 2 cut(s) 50, 232
Hpy8I GTNNAC 2 cut(s) 105, 168
HpyAV CCTTC 1 cut(s) 252
HpyF3I CTNAG 1 cut(s) 76
HspAI GCGC 1 cut(s) 197
Ksp22I TGATCA 1 cut(s) 67
Kzo9I GATC 1 cut(s) 67
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 2 cut(s) 19, 159
MhlI GDGCHC 1 cut(s) 253
MluCI AATT 1 cut(s) 215
MmeI TCCRAC 2 cut(s) 124, 219
MnlI CCTC 5 cut(s) 84, 91, 178, 228, 235
MseI TTAA 1 cut(s) 319
MspA1I CMGCKG 2 cut(s) 80, 291
MspR9I CCNGG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 112
NdeII GATC 1 cut(s) 67
PfeI GAWTC 1 cut(s) 228
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PspPI GGNCC 1 cut(s) 261
PvuII CAGCTG 2 cut(s) 80, 291
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 1 cut(s) 319
Sau3AI GATC 1 cut(s) 67
Sau96I GGNCC 1 cut(s) 261
ScrFI CCNGG 1 cut(s) 112
SduI GDGCHC 1 cut(s) 253
SetI ASST 5 cut(s) 82, 102, 239, 293, 318
SinI GGWCC 1 cut(s) 261
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
Sse9I AATT 1 cut(s) 215
StyD4I CCNGG 1 cut(s) 110
StyI CCWWGG 1 cut(s) 264
TasI AATT 1 cut(s) 215
TfiI GAWTC 1 cut(s) 228
Tru1I TTAA 1 cut(s) 319
Tru9I TTAA 1 cut(s) 319
TspDTI ATGAA 2 cut(s) 20, 261
VpaK11BI GGWCC 1 cut(s) 261
XmiI GTMKAC 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.