pycom16g10530

Heavy metal-associated isoprenylated plant protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
7204783 .. 7206626
1844 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g10530.2

Sequence Viewer

Length: 273 bp
ATGGAGGCCTTTACTTGGCTAAAGAGAAAAGGGTTTGGGACAGCTGACCAAGTCCCCTTAAGAGAGGAGGTTATGTGCCTGCTTGCTGAGCTAGAATTCAACATGCACTGTGGACATTGTGCAGATGATGTCAAGAAATGCTGCAGTAAGACGAAAGGAGTTGAAAGTGTTGAGGTTGATCAAGTGAACAAAGTAGTGACAGTGGAAGGAAGATTTCGTCATAAAAAGCTTCTCAAATGCCTCCGAAGGGCTAACAAGATTGTTAAAGGCTAG

Protein Analysis

91

Amino Acids

10.27

Weight (kDa)

9.15

Isoelectric Point (pI)

36.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019744)

Species Orthologous Gene IDs
malus_domestica MD13G1122700.v1.1
prunus_persica Prupe.1G222500_v2.0.a1
pyrus_communis pycom16g10530
rosa_roxburghii Rroxscaffold_5G00371540
rosa_samantha Rh4AG294400 Rh4BG300400 Rh4DG297500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 95
AfiI CCNNNNNNNGG 2 cut(s) 15, 247
AflII CTTAAG 1 cut(s) 58
AgsI TTSAA 2 cut(s) 100, 164
AluBI AGCT 3 cut(s) 44, 91, 229
AluI AGCT 3 cut(s) 44, 91, 229
AoxI GGCC 1 cut(s) 6
ApeKI GCWGC 1 cut(s) 141
ApoI RAATTY 1 cut(s) 95
BbvI GCAGC 1 cut(s) 128
BclI TGATCA 1 cut(s) 178
BfaI CTAG 2 cut(s) 92, 271
BfmI CTRYAG 1 cut(s) 142
BfrI CTTAAG 1 cut(s) 58
BisI GCNGC 1 cut(s) 142
BlpI GCTNAGC 1 cut(s) 87
BlsI GCNGC 1 cut(s) 143
Bpu1102I GCTNAGC 1 cut(s) 87
BsaXI ACNNNNNCTCC 2 cut(s) 59, 89
Bsc4I CCNNNNNNNGG 2 cut(s) 15, 247
BseLI CCNNNNNNNGG 2 cut(s) 15, 247
BseMII CTCAG 1 cut(s) 78
BseRI GAGGAG 1 cut(s) 80
BseXI GCAGC 1 cut(s) 128
BsgI GTGCAG 1 cut(s) 141
BshFI GGCC 1 cut(s) 8
BslFI GGGAC 2 cut(s) 38, 52
BslI CCNNNNNNNGG 2 cut(s) 15, 247
BsmFI GGGAC 2 cut(s) 38, 52
BsnI GGCC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 178
Bsp1720I GCTNAGC 1 cut(s) 87
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 79
BspMAI CTGCAG 1 cut(s) 146
BspTI CTTAAG 1 cut(s) 58
BssMI GATC 1 cut(s) 178
Bst4CI ACNGT 2 cut(s) 110, 202
BstAFI CTTAAG 1 cut(s) 58
BstC8I GCNNGC 2 cut(s) 80, 84
BstDEI CTNAG 1 cut(s) 87
BstKTI GATC 1 cut(s) 181
BstMBI GATC 1 cut(s) 178
BstMWI GCNNNNNNNGC 1 cut(s) 88
BstNSI RCATGY 1 cut(s) 106
BstSFI CTRYAG 1 cut(s) 142
BstV1I GCAGC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 8
BtsIMutI CAGTG 2 cut(s) 106, 207
Cac8I GCNNGC 2 cut(s) 80, 84
CviAII CATG 1 cut(s) 103
CviJI RGCY 7 cut(s) 8, 19, 44, 91, 229, 251, 270
CviKI_1 RGCY 7 cut(s) 8, 19, 44, 91, 229, 251, 270
DdeI CTNAG 1 cut(s) 87
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
Eco147I AGGCCT 1 cut(s) 8
EcoRI GAATTC 1 cut(s) 95
FaeI CATG 1 cut(s) 106
FaiI YATR 3 cut(s) 74, 104, 222
FaqI GGGAC 2 cut(s) 38, 52
FatI CATG 1 cut(s) 102
FbaI TGATCA 1 cut(s) 178
Fnu4HI GCNGC 1 cut(s) 142
Fsp4HI GCNGC 1 cut(s) 142
FspBI CTAG 2 cut(s) 92, 271
GluI GCNGC 1 cut(s) 142
HaeIII GGCC 1 cut(s) 8
Hin1II CATG 1 cut(s) 106
HindIII AAGCTT 1 cut(s) 227
Hpy166II GTNNAC 2 cut(s) 113, 187
Hpy188I TCNGA 1 cut(s) 245
Hpy188III TCNNGA 1 cut(s) 133
Hpy8I GTNNAC 2 cut(s) 113, 187
HpyAV CCTTC 2 cut(s) 200, 240
HpyCH4III ACNGT 2 cut(s) 110, 202
HpyCH4V TGCA 3 cut(s) 106, 122, 144
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
HpyF3I CTNAG 1 cut(s) 87
Hsp92II CATG 1 cut(s) 106
Ksp22I TGATCA 1 cut(s) 178
Kzo9I GATC 1 cut(s) 178
LpnPI CCDG 1 cut(s) 92
Lsp1109I GCAGC 1 cut(s) 128
MaeI CTAG 2 cut(s) 92, 271
MaeIII GTNAC 1 cut(s) 196
MalI GATC 1 cut(s) 180
MboI GATC 1 cut(s) 178
MboII GAAGA 1 cut(s) 222
MluCI AATT 1 cut(s) 95
MnlI CCTC 4 cut(s) 58, 61, 166, 251
MseI TTAA 2 cut(s) 59, 264
MspA1I CMGCKG 1 cut(s) 44
MspCI CTTAAG 1 cut(s) 58
MwoI GCNNNNNNNGC 1 cut(s) 88
NdeII GATC 1 cut(s) 178
NlaIII CATG 1 cut(s) 106
NmuCI GTSAC 1 cut(s) 196
NspI RCATGY 1 cut(s) 106
PceI AGGCCT 1 cut(s) 8
PflFI GACNNNGTC 1 cut(s) 50
PkrI GCNGC 1 cut(s) 143
PstI CTGCAG 1 cut(s) 146
PsyI GACNNNGTC 1 cut(s) 50
PvuII CAGCTG 1 cut(s) 44
SaqAI TTAA 2 cut(s) 59, 264
SatI GCNGC 1 cut(s) 142
Sau3AI GATC 1 cut(s) 178
SetI ASST 5 cut(s) 46, 72, 93, 177, 231
SfcI CTRYAG 1 cut(s) 142
SgeI CNNG 9 cut(s) 27, 62, 91, 95, 104, 115, 145, 194, 268
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
Sse9I AATT 1 cut(s) 95
SseBI AGGCCT 1 cut(s) 8
SspMI CTAG 2 cut(s) 92, 271
StuI AGGCCT 1 cut(s) 8
TaaI ACNGT 2 cut(s) 110, 202
TasI AATT 1 cut(s) 95
Tru1I TTAA 2 cut(s) 59, 264
Tru9I TTAA 2 cut(s) 59, 264
TscAI CASTG 2 cut(s) 113, 207
TseFI GTSAC 1 cut(s) 196
TseI GCWGC 1 cut(s) 141
Tsp45I GTSAC 1 cut(s) 196
TspRI CASTG 2 cut(s) 113, 207
Tth111I GACNNNGTC 1 cut(s) 50
Vha464I CTTAAG 1 cut(s) 58
XapI RAATTY 1 cut(s) 95
XceI RCATGY 1 cut(s) 106
XspI CTAG 2 cut(s) 92, 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.