pycom16g15850

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0020124
Physical Location & Seq
Reverse (-)
11764497 .. 11764889
393 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g15850.1

Sequence Viewer

Length: 393 bp
ATGACTCCATTTGAAGCACTTTGCGGAAAACAACCCCCCACAGTTCAAACTTATATCCCTGGCTCCCCTGCAGTTAATCAGGTAGACATTGCTTTACAATCACGTGATGACTTGCTATCTCGTCTTCGCCACAATATGCTCTTGGCTCAAAATAGAATGAAACAGAAAGTTGACAAACACAGGAGACAGCGTGAATTTGAAGTAGGTGATTTGGTATTTCTAAAGCTACAGACTTACTGTCAAGCTTCTCACCAAAATCACAAGTTATCTCCAAGGTATTATGGCCCTTACAAGATTTTAGCAAGAGTTGAAAAGTGGCATATCATTTGCAGCTTCATCACAATTCCAGAATTCATAATGTGTTTCATGTGTCACTGCTCAAGAAAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

15.31

Weight (kDa)

9.38

Isoelectric Point (pI)

51.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SH3_Tf2-1 PF24626 69 - 105 7.3e-10 Tf2-1-like, SH3 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020124)

Species Orthologous Gene IDs
malus_domestica MD14G1073300.v1.1
pyrus_communis pycom08g08560 pycom16g15850
rosa_wichuraiana Rw1G019750 Rw5G013010 Rw5G048260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 84
AciI CCGC 1 cut(s) 24
AcsI RAATTY 2 cut(s) 194, 350
AcvI CACGTG 1 cut(s) 104
AgsI TTSAA 4 cut(s) 14, 47, 200, 311
AhdI GACNNNNNGTC 1 cut(s) 237
AjnI CCWGG 1 cut(s) 58
AluBI AGCT 3 cut(s) 226, 245, 333
AluI AGCT 3 cut(s) 226, 245, 333
Alw26I GTCTC 1 cut(s) 178
AoxI GGCC 1 cut(s) 283
ApeKI GCWGC 1 cut(s) 330
ApoI RAATTY 2 cut(s) 194, 350
AspS9I GGNCC 1 cut(s) 284
AsuHPI GGTGA 2 cut(s) 218, 242
BbrPI CACGTG 1 cut(s) 104
BbsI GAAGAC 1 cut(s) 116
BbvI GCAGC 1 cut(s) 342
BciT130I CCWGG 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 178
BfmI CTRYAG 2 cut(s) 69, 227
BisI GCNGC 1 cut(s) 331
BlsI GCNGC 1 cut(s) 332
Bme1390I CCNGG 1 cut(s) 60
BmeRI GACNNNNNGTC 1 cut(s) 237
BmgT120I GGNCC 1 cut(s) 284
BmiI GGNNCC 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 60
BpiI GAAGAC 1 cut(s) 116
BpuEI CTTGAG 1 cut(s) 364
BsaAI YACGTR 1 cut(s) 104
BsaJI CCNNGG 2 cut(s) 58, 272
BsaXI ACNNNNNCTCC 2 cut(s) 175, 205
Bse3DI GCAATG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 60
BseDI CCNNGG 2 cut(s) 58, 272
BseMI GCAATG 1 cut(s) 87
BseXI GCAGC 1 cut(s) 342
BshFI GGCC 1 cut(s) 285
BsmAI GTCTC 1 cut(s) 178
BsnI GGCC 1 cut(s) 285
BspACI CCGC 1 cut(s) 24
BspANI GGCC 1 cut(s) 285
BspLI GGNNCC 1 cut(s) 64
BspMAI CTGCAG 1 cut(s) 73
BsrDI GCAATG 1 cut(s) 87
BssECI CCNNGG 2 cut(s) 58, 272
BssT1I CCWWGG 1 cut(s) 272
Bst2UI CCWGG 1 cut(s) 60
Bst4CI ACNGT 2 cut(s) 43, 239
BstBAI YACGTR 1 cut(s) 104
BstMAI GTCTC 1 cut(s) 178
BstNI CCWGG 1 cut(s) 60
BstSCI CCNGG 1 cut(s) 58
BstSFI CTRYAG 2 cut(s) 69, 227
BstV1I GCAGC 1 cut(s) 342
BstV2I GAAGAC 1 cut(s) 116
BsuRI GGCC 1 cut(s) 285
BtsI GCAGTG 1 cut(s) 373
BtsIMutI CAGTG 1 cut(s) 373
Cfr13I GGNCC 1 cut(s) 284
CviAII CATG 1 cut(s) 367
CviJI RGCY 6 cut(s) 63, 146, 226, 245, 285, 333
CviKI_1 RGCY 6 cut(s) 63, 146, 226, 245, 285, 333
DriI GACNNNNNGTC 1 cut(s) 237
Eam1105I GACNNNNNGTC 1 cut(s) 237
Eco130I CCWWGG 1 cut(s) 272
Eco72I CACGTG 1 cut(s) 104
EcoRI GAATTC 1 cut(s) 350
EcoRII CCWGG 1 cut(s) 58
EcoT14I CCWWGG 1 cut(s) 272
ErhI CCWWGG 1 cut(s) 272
FaeI CATG 1 cut(s) 370
FaiI YATR 6 cut(s) 54, 137, 282, 321, 356, 368
FatI CATG 1 cut(s) 366
FblI GTMKAC 1 cut(s) 84
Fnu4HI GCNGC 1 cut(s) 331
Fsp4HI GCNGC 1 cut(s) 331
GluI GCNGC 1 cut(s) 331
HaeIII GGCC 1 cut(s) 285
Hin1II CATG 1 cut(s) 370
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HindIII AAGCTT 1 cut(s) 243
HinfI GANTC 1 cut(s) 4
HphI GGTGA 2 cut(s) 218, 242
Hpy166II GTNNAC 2 cut(s) 85, 172
Hpy188III TCNNGA 2 cut(s) 347, 381
Hpy8I GTNNAC 2 cut(s) 85, 172
HpyCH4III ACNGT 2 cut(s) 43, 239
HpyCH4IV ACGT 1 cut(s) 103
HpyCH4V TGCA 2 cut(s) 71, 330
HpySE526I ACGT 1 cut(s) 103
Hsp92II CATG 1 cut(s) 370
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 6 cut(s) 45, 65, 72, 81, 166, 360
Lsp1109I GCAGC 1 cut(s) 342
MaeII ACGT 1 cut(s) 103
MaeIII GTNAC 1 cut(s) 371
MboII GAAGA 1 cut(s) 116
MluCI AATT 3 cut(s) 194, 342, 350
MseI TTAA 1 cut(s) 75
MspR9I CCNGG 1 cut(s) 60
MvaI CCWGG 1 cut(s) 60
NlaIII CATG 1 cut(s) 370
NlaIV GGNNCC 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 371
PkrI GCNGC 1 cut(s) 332
PmaCI CACGTG 1 cut(s) 104
PmlI CACGTG 1 cut(s) 104
Ppu21I YACGTR 1 cut(s) 104
Psp6I CCWGG 1 cut(s) 58
PspCI CACGTG 1 cut(s) 104
PspGI CCWGG 1 cut(s) 58
PspN4I GGNNCC 1 cut(s) 64
PspPI GGNCC 1 cut(s) 284
PstI CTGCAG 1 cut(s) 73
SaqAI TTAA 1 cut(s) 75
SatI GCNGC 1 cut(s) 331
Sau96I GGNCC 1 cut(s) 284
ScrFI CCNGG 1 cut(s) 60
SetI ASST 7 cut(s) 84, 106, 208, 228, 247, 278, 335
SfcI CTRYAG 2 cut(s) 69, 227
SmlI CTYRAG 1 cut(s) 379
SmoI CTYRAG 1 cut(s) 379
Sse9I AATT 3 cut(s) 194, 342, 350
SsiI CCGC 1 cut(s) 24
StyD4I CCNGG 1 cut(s) 58
StyI CCWWGG 1 cut(s) 272
TaaI ACNGT 2 cut(s) 43, 239
TaiI ACGT 1 cut(s) 106
TasI AATT 3 cut(s) 194, 342, 350
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 380
TseFI GTSAC 1 cut(s) 371
TseI GCWGC 1 cut(s) 330
Tsp45I GTSAC 1 cut(s) 371
TspDTI ATGAA 4 cut(s) 173, 325, 343, 355
TspRI CASTG 1 cut(s) 380
XapI RAATTY 2 cut(s) 194, 350
XmiI GTMKAC 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.