Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0020165

Physical Location & Seq

Genomic Coordinates Forward (+)

476 .. 1607

Gene Structure 1132 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

ATGCTATTTCCCATGCTTGTATTGGTTTTATTTACGTTATTCGTTGGGGCCATTGGAATTCCTTTCTTCAATTATGAAGGAATGGATTTAGATATATTATCCAAATTGTTAACTCCGTCCATAAACCTTTTACATCAAAACCGAACCCACTCTGTCGATTGGTATGAATTTCTCACAAACGTAGTTTTTCAGTCAGTATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00190 ko01100 map00190 map01100

Pfam Domains

Protein Families

Proton_antipo_C Proton_antipo_M Proton_antipo_N

Protein Analysis

66

Amino Acids

7.62

Weight (kDa)

4.8

Isoelectric Point (pI)

14.62

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Proton_antipo_C	PF01010	1 - 63	7e-27	NADH-dehyrogenase subunit F, TMs, (complex I) C-terminus

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020165)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG01010
fragaria_vesca	FvH4_c3g00021
malus_domestica	MD00G1121700.v1.1
prunus_persica	Prupe.2G145900_v2.0.a1
rosa_chinensis	RchiOBHm_CPg0501681
rosa_laevigata	RLG00000000210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	57, 167
AgsI	TTSAA	1 cut(s)	70
AoxI	GGCC	1 cut(s)	48
ApoI	RAATTY	2 cut(s)	57, 167
AspS9I	GGNCC	1 cut(s)	48
BmgT120I	GGNCC	1 cut(s)	48
BmiI	GGNNCC	1 cut(s)	49
BshFI	GGCC	1 cut(s)	50
BsnI	GGCC	1 cut(s)	50
BspANI	GGCC	1 cut(s)	50
BspLI	GGNNCC	1 cut(s)	49
BsuRI	GGCC	1 cut(s)	50
Cfr13I	GGNCC	1 cut(s)	48
CviAII	CATG	1 cut(s)	13
CviJI	RGCY	1 cut(s)	50
CviKI_1	RGCY	1 cut(s)	50
EcoRI	GAATTC	1 cut(s)	57
FaeI	CATG	1 cut(s)	16
FaiI	YATR	6 cut(s)	14, 75, 95, 122, 165, 199
FatI	CATG	1 cut(s)	12
HaeIII	GGCC	1 cut(s)	50
Hin1II	CATG	1 cut(s)	16
HincII	GTYRAC	1 cut(s)	111
HindII	GTYRAC	1 cut(s)	111
HpaI	GTTAAC	1 cut(s)	111
Hpy166II	GTNNAC	1 cut(s)	111
Hpy8I	GTNNAC	1 cut(s)	111
HpyAV	CCTTC	1 cut(s)	71
HpyCH4IV	ACGT	2 cut(s)	35, 180
HpySE526I	ACGT	2 cut(s)	35, 180
Hsp92II	CATG	1 cut(s)	16
KspAI	GTTAAC	1 cut(s)	111
MaeII	ACGT	2 cut(s)	35, 180
MboII	GAAGA	1 cut(s)	58
MluCI	AATT	4 cut(s)	57, 70, 104, 167
MseI	TTAA	1 cut(s)	110
NlaIII	CATG	1 cut(s)	16
NlaIV	GGNNCC	1 cut(s)	49
PspN4I	GGNNCC	1 cut(s)	49
PspPI	GGNCC	1 cut(s)	48
SaqAI	TTAA	1 cut(s)	110
Sau96I	GGNCC	1 cut(s)	48
SetI	ASST	3 cut(s)	38, 129, 183
SgeI	CNNG	2 cut(s)	25, 29
Sse9I	AATT	4 cut(s)	57, 70, 104, 167
TaiI	ACGT	2 cut(s)	38, 183
TaqI	TCGA	1 cut(s)	156
TasI	AATT	4 cut(s)	57, 70, 104, 167
Tru1I	TTAA	1 cut(s)	110
Tru9I	TTAA	1 cut(s)	110
TspDTI	ATGAA	2 cut(s)	90, 180
TspGWI	ACGGA	1 cut(s)	105
XapI	RAATTY	2 cut(s)	57, 167
XcmI	CCANNNNNNNNNTGG	1 cut(s)	19

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.