RchiOBHm_Chr7g0226281

UPF0481 protein At3g47200-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0019437
Physical Location & Seq
Forward (+)
49405949 .. 49406383
435 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 435 bp
ATGAGGCTTCCCAGTGGTGAACCTCGACAAGATTTTGTAGTTCGATATCATATCCAGTCAGCTACAAAGCTTCATCTTGCTGGAGTTAAATTCAAGTTGAGCAAGGCAAGGAGTTTCTTAGATATCAAATTTTCCGATGGAGTGCTTGAAATCCCAGAGCTAAAATTAGACAATCTTTCTATCAAGCTATGGCTGAGTTTCATTGCACTTGAACAATGCTCCTATCATTCCTCAAGACTTATAACAACATATGCTGAATTCATGAGTTGCCTAGTCTACAAGCTTAAGGATGCAGAGCTTCTCTACCATAGTATTATCAAGAACTATATAGCCTATGAGGAGATTGCAAATACTATTACAAACATCAGCAAAGGTGTCGCTATTGATTTTGAGCAGGGTTACCTACTGAATCGATCCGTTCAAAGATGTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

144

Amino Acids

16.6

Weight (kDa)

8.73

Isoelectric Point (pI)

41.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 15 - 138 3.5e-28 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019437)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0226281
rosa_rugosa Rorug05G0228300
rosa_samantha Rh7AG383000 Rh7AG383100 Rh7CG402500 Rh7CG402600 Rh7DG381300 Rh7DG381400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 242
AccI GTMKAC 1 cut(s) 276
AclWI GGATC 1 cut(s) 408
AcsI RAATTY 3 cut(s) 89, 128, 257
AflII CTTAAG 1 cut(s) 284
AgsI TTSAA 4 cut(s) 94, 149, 212, 422
AluBI AGCT 6 cut(s) 62, 70, 160, 187, 283, 298
AluI AGCT 6 cut(s) 62, 70, 160, 187, 283, 298
AlwI GGATC 1 cut(s) 408
ApoI RAATTY 3 cut(s) 89, 128, 257
AsuHPI GGTGA 1 cut(s) 29
BccI CCATC 1 cut(s) 131
BcgI CGANNNNNNTGC 2 cut(s) 358, 392
BfaI CTAG 1 cut(s) 272
BfrI CTTAAG 1 cut(s) 284
BmrI ACTGGG 1 cut(s) 6
BmsI GCATC 1 cut(s) 280
BmuI ACTGGG 1 cut(s) 6
BpmI CTGGAG 1 cut(s) 102
BpuEI CTTGAG 1 cut(s) 217
Bsa29I ATCGAT 1 cut(s) 412
Bse1I ACTGG 2 cut(s) 12, 55
Bse3DI GCAATG 1 cut(s) 201
BseCI ATCGAT 1 cut(s) 412
BseGI GGATG 1 cut(s) 295
BseMI GCAATG 1 cut(s) 201
BseMII CTCAG 1 cut(s) 185
BseNI ACTGG 2 cut(s) 12, 55
BseRI GAGGAG 1 cut(s) 353
BshVI ATCGAT 1 cut(s) 412
Bsp143I GATC 1 cut(s) 413
BspCNI CTCAG 1 cut(s) 186
BspDI ATCGAT 1 cut(s) 412
BspHI TCATGA 1 cut(s) 261
BspPI GGATC 1 cut(s) 408
BspTI CTTAAG 1 cut(s) 284
BsrDI GCAATG 1 cut(s) 201
BsrI ACTGG 2 cut(s) 12, 55
BssMI GATC 1 cut(s) 413
BstAFI CTTAAG 1 cut(s) 284
BstDEI CTNAG 2 cut(s) 118, 194
BstEII GGTNACC 1 cut(s) 398
BstF5I GGATG 1 cut(s) 295
BstKTI GATC 1 cut(s) 416
BstMBI GATC 1 cut(s) 413
BstPI GGTNACC 1 cut(s) 398
Bsu15I ATCGAT 1 cut(s) 412
BsuTUI ATCGAT 1 cut(s) 412
BtsCI GGATG 1 cut(s) 295
BtsIMutI CAGTG 1 cut(s) 19
CciI TCATGA 1 cut(s) 261
ClaI ATCGAT 1 cut(s) 412
CviAII CATG 1 cut(s) 262
CviJI RGCY 9 cut(s) 7, 62, 70, 160, 187, 193, 283, 298, 332
CviKI_1 RGCY 9 cut(s) 7, 62, 70, 160, 187, 193, 283, 298, 332
DdeI CTNAG 2 cut(s) 118, 194
DpnI GATC 1 cut(s) 415
DpnII GATC 1 cut(s) 413
Eco32I GATATC 2 cut(s) 47, 124
Eco91I GGTNACC 1 cut(s) 398
EcoO65I GGTNACC 1 cut(s) 398
EcoRI GAATTC 1 cut(s) 257
EcoRV GATATC 2 cut(s) 47, 124
FaeI CATG 1 cut(s) 265
FatI CATG 1 cut(s) 261
FauNDI CATATG 1 cut(s) 250
FblI GTMKAC 1 cut(s) 276
FokI GGATG 1 cut(s) 302
FspBI CTAG 1 cut(s) 272
GsuI CTGGAG 1 cut(s) 102
Hin1II CATG 1 cut(s) 265
HindIII AAGCTT 2 cut(s) 68, 281
HinfI GANTC 1 cut(s) 409
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 2 cut(s) 20, 277
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 3 cut(s) 234, 262, 319
Hpy8I GTNNAC 2 cut(s) 20, 277
HpyCH4V TGCA 3 cut(s) 206, 293, 347
HpyF3I CTNAG 2 cut(s) 118, 194
Hsp92II CATG 1 cut(s) 265
Kzo9I GATC 1 cut(s) 413
LmnI GCTCC 1 cut(s) 224
LpnPI CCDG 5 cut(s) 25, 66, 68, 168, 380
LweI GCATC 1 cut(s) 280
MaeI CTAG 1 cut(s) 272
MaeIII GTNAC 1 cut(s) 398
MalI GATC 1 cut(s) 415
MboI GATC 1 cut(s) 413
MluCI AATT 5 cut(s) 89, 128, 164, 257, 430
MnlI CCTC 3 cut(s) 33, 241, 331
MseI TTAA 2 cut(s) 87, 285
MspCI CTTAAG 1 cut(s) 284
NdeI CATATG 1 cut(s) 250
NdeII GATC 1 cut(s) 413
NlaIII CATG 1 cut(s) 265
PagI TCATGA 1 cut(s) 261
PfeI GAWTC 1 cut(s) 409
PsiI TTATAA 1 cut(s) 242
PspEI GGTNACC 1 cut(s) 398
SaqAI TTAA 2 cut(s) 87, 285
Sau3AI GATC 1 cut(s) 413
SetI ASST 9 cut(s) 25, 64, 72, 162, 189, 285, 300, 376, 405
SfaNI GCATC 1 cut(s) 280
SmlI CTYRAG 2 cut(s) 232, 284
SmoI CTYRAG 2 cut(s) 232, 284
Sse9I AATT 5 cut(s) 89, 128, 164, 257, 430
SspMI CTAG 1 cut(s) 272
TaqI TCGA 3 cut(s) 25, 43, 412
TasI AATT 5 cut(s) 89, 128, 164, 257, 430
TfiI GAWTC 1 cut(s) 409
Tru1I TTAA 2 cut(s) 87, 285
Tru9I TTAA 2 cut(s) 87, 285
TscAI CASTG 1 cut(s) 19
TspDTI ATGAA 3 cut(s) 62, 190, 250
TspGWI ACGGA 1 cut(s) 406
TspRI CASTG 1 cut(s) 19
Vha464I CTTAAG 1 cut(s) 284
XapI RAATTY 3 cut(s) 89, 128, 257
XmiI GTMKAC 1 cut(s) 276
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.