Rh7CG402600

UPF0481 protein At3g47200-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0019437
Physical Location & Seq
Forward (+)
51428356 .. 51428793
438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG402600.1

Sequence Viewer

Length: 438 bp
ATGAGGCTTCCCAGCGGTGAACCTCGACAAGATTTTGTAGTTCGATATCGTATCCAATCAGCTACAAAGCTTCATCTTGCTGGAGTTAAATTCAAGTTGAGTGACGCAAGGAGTTTCTTAGATATCAAATTTTCTGATGGAGTGCTTGAAATCCCAGAGCTAAAACTAGACGATCTTTCTATCAAGCTATGGCTGAGTTTCATTGCACTTGAACAATGCTCCTATCATTCCTCAAGACTCATAACAACATATGCTGAATTCGTGAGTCGCTTAGTCCGCAAGCTTAAGGACGCAGAGCTTCTCTACCATAATAGTATTATCGAGAACTATTTAGCCTATGAGGAGATTGCAAATACTATTACAAACATCAGCAAAGGTGTCACTATTGATTTTGAGCAGGGTTACCTACTGAATCGATCTGTTCAAAGATGTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

145

Amino Acids

16.76

Weight (kDa)

7.76

Isoelectric Point (pI)

36.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 15 - 139 1.7e-29 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019437)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0226281
rosa_rugosa Rorug05G0228300
rosa_samantha Rh7AG383000 Rh7AG383100 Rh7CG402500 Rh7CG402600 Rh7DG381300 Rh7DG381400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 15, 277
AcsI RAATTY 3 cut(s) 89, 128, 257
AflII CTTAAG 1 cut(s) 284
AgsI TTSAA 4 cut(s) 94, 149, 212, 425
AluBI AGCT 6 cut(s) 62, 70, 160, 187, 283, 298
AluI AGCT 6 cut(s) 62, 70, 160, 187, 283, 298
ApoI RAATTY 3 cut(s) 89, 128, 257
AsuHPI GGTGA 1 cut(s) 29
BccI CCATC 1 cut(s) 131
BciVI GTATCC 1 cut(s) 62
BfaI CTAG 1 cut(s) 167
BfrI CTTAAG 1 cut(s) 284
BfuI GTATCC 1 cut(s) 62
BpmI CTGGAG 1 cut(s) 102
BpuEI CTTGAG 1 cut(s) 217
Bsa29I ATCGAT 1 cut(s) 415
Bse3DI GCAATG 1 cut(s) 201
BseCI ATCGAT 1 cut(s) 415
BseMI GCAATG 1 cut(s) 201
BseMII CTCAG 1 cut(s) 185
BseRI GAGGAG 1 cut(s) 356
BseYI CCCAGC 1 cut(s) 11
BshVI ATCGAT 1 cut(s) 415
Bsp143I GATC 2 cut(s) 172, 416
BspACI CCGC 2 cut(s) 15, 277
BspCNI CTCAG 1 cut(s) 186
BspDI ATCGAT 1 cut(s) 415
BspTI CTTAAG 1 cut(s) 284
BsrDI GCAATG 1 cut(s) 201
BssMI GATC 2 cut(s) 172, 416
BstAFI CTTAAG 1 cut(s) 284
BstC8I GCNNGC 1 cut(s) 281
BstDEI CTNAG 3 cut(s) 118, 194, 271
BstEII GGTNACC 1 cut(s) 401
BstKTI GATC 2 cut(s) 175, 419
BstMBI GATC 2 cut(s) 172, 416
BstMWI GCNNNNNNNGC 1 cut(s) 276
BstPI GGTNACC 1 cut(s) 401
Bsu15I ATCGAT 1 cut(s) 415
BsuI GTATCC 1 cut(s) 62
BsuTUI ATCGAT 1 cut(s) 415
Cac8I GCNNGC 1 cut(s) 281
ClaI ATCGAT 1 cut(s) 415
CseI GACGC 2 cut(s) 113, 299
CviJI RGCY 9 cut(s) 7, 62, 70, 160, 187, 193, 283, 298, 335
CviKI_1 RGCY 9 cut(s) 7, 62, 70, 160, 187, 193, 283, 298, 335
DdeI CTNAG 3 cut(s) 118, 194, 271
DpnI GATC 2 cut(s) 174, 418
DpnII GATC 2 cut(s) 172, 416
Eco32I GATATC 2 cut(s) 47, 124
Eco91I GGTNACC 1 cut(s) 401
EcoO65I GGTNACC 1 cut(s) 401
EcoRI GAATTC 1 cut(s) 257
EcoRV GATATC 2 cut(s) 47, 124
FaiI YATR 6 cut(s) 190, 242, 250, 252, 309, 339
FauNDI CATATG 1 cut(s) 250
FspBI CTAG 1 cut(s) 167
GsaI CCCAGC 1 cut(s) 15
GsuI CTGGAG 1 cut(s) 102
HgaI GACGC 2 cut(s) 113, 299
HindIII AAGCTT 2 cut(s) 68, 281
HinfI GANTC 3 cut(s) 237, 265, 412
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 20
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 3 cut(s) 234, 262, 322
Hpy8I GTNNAC 1 cut(s) 20
HpyCH4V TGCA 2 cut(s) 206, 350
HpyF10VI GCNNNNNNNGC 1 cut(s) 276
HpyF3I CTNAG 3 cut(s) 118, 194, 271
Kzo9I GATC 2 cut(s) 172, 416
LmnI GCTCC 1 cut(s) 224
LpnPI CCDG 4 cut(s) 25, 66, 168, 383
MaeI CTAG 1 cut(s) 167
MaeIII GTNAC 3 cut(s) 101, 379, 401
MalI GATC 2 cut(s) 174, 418
MboI GATC 2 cut(s) 172, 416
MluCI AATT 4 cut(s) 89, 128, 257, 433
MlyI GAGTC 2 cut(s) 231, 274
MnlI CCTC 3 cut(s) 33, 241, 334
MseI TTAA 2 cut(s) 87, 285
MspA1I CMGCKG 1 cut(s) 15
MspCI CTTAAG 1 cut(s) 284
MwoI GCNNNNNNNGC 1 cut(s) 276
NdeI CATATG 1 cut(s) 250
NdeII GATC 2 cut(s) 172, 416
NmuCI GTSAC 2 cut(s) 101, 379
PfeI GAWTC 1 cut(s) 412
PleI GAGTC 2 cut(s) 231, 273
PpsI GAGTC 2 cut(s) 231, 273
PspEI GGTNACC 1 cut(s) 401
PspFI CCCAGC 1 cut(s) 11
SaqAI TTAA 2 cut(s) 87, 285
Sau3AI GATC 2 cut(s) 172, 416
SchI GAGTC 2 cut(s) 231, 274
SetI ASST 9 cut(s) 25, 64, 72, 162, 189, 285, 300, 379, 408
SmlI CTYRAG 2 cut(s) 232, 284
SmoI CTYRAG 2 cut(s) 232, 284
Sse9I AATT 4 cut(s) 89, 128, 257, 433
SsiI CCGC 2 cut(s) 15, 277
SspMI CTAG 1 cut(s) 167
TaqI TCGA 4 cut(s) 25, 43, 321, 415
TasI AATT 4 cut(s) 89, 128, 257, 433
TfiI GAWTC 1 cut(s) 412
Tru1I TTAA 2 cut(s) 87, 285
Tru9I TTAA 2 cut(s) 87, 285
TseFI GTSAC 2 cut(s) 101, 379
Tsp45I GTSAC 2 cut(s) 101, 379
TspDTI ATGAA 2 cut(s) 62, 190
Vha464I CTTAAG 1 cut(s) 284
XapI RAATTY 3 cut(s) 89, 128, 257
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.