RchiOBHm_Chr6g0278571

Zeaxanthin epoxidase, chloroplastic-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0018908
Physical Location & Seq
Reverse (-)
41678744 .. 41681249
2506 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1116 bp
ATGTCTACAGAGAAAGAGCTAGAGAAGAACCCTGCTCAGTTGAAAAAATATATCTTACGCAAGCTCGGAAAGGTACAAGATGAAGTAAGGGCTGTTATAGAAAACACTGAATTGGATGCTTTTATATCCACTCCAGTGAGATATAGGCACCCTTGGGAACTGCTTTGGGGAAATATTAGCAAAGGTGGTGTATGTGTTGCTGGAGACGCACTCCACCCCATGACCCCAGACATCGGCCAAGGTGGCTGTGCTGCATTAGAAGACGGTGTTGTATTAGCAAGATGTCTCGGTGAGGCTTTGTTGAAGAACCGGAGGCAAGAAATTAGAGATAAAGATGAAGAACGAAAAGAGGAATGTAAGAGGATTGAAATGGGGTTGAGGAATTATGCCAGTAAGAGGAAATGGAGAAGCATTGATCTGATTATTACATCTTATGTGTTTTATTTAATACAGGAGATTGATGGAAAAGTAATGTCTTTCTTGAGGAACAAGTTTTTTTCTCCAATCCTACCCTGGCTGCTGTTGAAGAAGGCTGATTTTGATTGCTGGGGACTCGAAGTAGTGTTGGAATCATGGGATAGTTTGAGGACTACAGGGTTTGTTTTGAATACATGGACAAATGCCTGGAAAGCCTTAGAAGCCATTGGTGTTGCTGATGCTCTTCGGCTAATAAATTACAGATTTCGTGGAGTAGACCATGAAGTTCGTTGTGTGCAAAGGAAGCTGTTGTTGGATTCCCTTGCAAATGAACTTTCTAGTGCCACAACCAGGTTCTCATCAAAAGTTGTTTCAATCGAAGAATCAGGCTACTTTAAGCTTCTACATCTTGCTGATGGAACCATCCTTAAAGTTAAGAGAGTCTTGGTTGGGTGTGATGGAGTCAACTCTGTGGTTGCAAAATGGCTAAACTTCAAGCAGCAATCATGGAATCCAGCTCAATTGAGGCAATTTGTGTTGAGCAAGCTAGGAAAGATTCCTGATGCAGTAAGGGCTACTATAGAAAACACTGAACTGGATGCTTTTATATCGTCTCCCTTGAGATATAAACCTCCTTGGGAGGTTCTTTGGGGACAGCTAATGTGGTTGGTTTTATGCAGGGGAGCTAAGGAAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAD_binding_3

Protein Analysis

371

Amino Acids

42.39

Weight (kDa)

9.05

Isoelectric Point (pI)

43.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FAD_binding_3 PF01494 57 - 116 2.6e-06 FAD binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018908)

Species Orthologous Gene IDs
prunus_persica Prupe.8G167400_v2.0.a1 Prupe.8G167400_v2.0.a1 Prupe.I003800_v2.0.a1 Prupe.I004000_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0278571
rosa_multiflora Rmu_sc0000258.1_g000078
rosa_roxburghii Rroxscaffold_7G00190180
rosa_rugosa Rorug06G0118400
rosa_samantha Rh6DG225700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 147
AccI GTMKAC 2 cut(s) 5, 693
AcoI YGGCCR 1 cut(s) 235
AfaI GTAC 1 cut(s) 75
AfiI CCNNNNNNNGG 3 cut(s) 233, 396, 768
AgsI TTSAA 7 cut(s) 43, 304, 368, 526, 607, 792, 913
AjnI CCWGG 3 cut(s) 512, 623, 767
AjuI GAANNNNNNNTTGG 2 cut(s) 713, 745
AleI CACNNNNGTG 1 cut(s) 134
AluBI AGCT 8 cut(s) 19, 64, 724, 817, 935, 964, 1075, 1103
AluI AGCT 8 cut(s) 19, 64, 724, 817, 935, 964, 1075, 1103
Alw26I GTCTC 3 cut(s) 198, 290, 1035
AoxI GGCC 1 cut(s) 235
ApeKI GCWGC 3 cut(s) 251, 517, 916
AsuHPI GGTGA 1 cut(s) 302
BanI GGYRCC 1 cut(s) 147
BbsI GAAGAC 1 cut(s) 267
BbvI GCAGC 3 cut(s) 238, 504, 928
BccI CCATC 4 cut(s) 455, 827, 848, 869
BciT130I CCWGG 3 cut(s) 514, 625, 769
BcoDI GTCTC 3 cut(s) 198, 290, 1035
BfaI CTAG 3 cut(s) 20, 756, 965
BfmI CTRYAG 3 cut(s) 6, 591, 996
BglI GCCNNNNNGGC 1 cut(s) 243
BisI GCNGC 3 cut(s) 252, 518, 917
BlsI GCNGC 3 cut(s) 253, 519, 918
Bme1390I CCNGG 3 cut(s) 514, 625, 769
BmiI GGNNCC 2 cut(s) 149, 838
BmrFI CCNGG 3 cut(s) 514, 625, 769
BmsI GCATC 4 cut(s) 106, 646, 970, 1006
BpiI GAAGAC 1 cut(s) 267
BplI GAGNNNNNCTC 2 cut(s) 195, 227
BpmI CTGGAG 2 cut(s) 117, 222
Bpu10I CCTNAGC 1 cut(s) 1104
BpuEI CTTGAG 2 cut(s) 502, 1057
BsaJI CCNNGG 4 cut(s) 152, 238, 512, 1052
BsaWI WCCGGW 1 cut(s) 309
Bsc4I CCNNNNNNNGG 3 cut(s) 233, 396, 768
Bse1I ACTGG 3 cut(s) 134, 390, 1017
BseBI CCWGG 3 cut(s) 514, 625, 769
BseDI CCNNGG 4 cut(s) 152, 238, 512, 1052
BseGI GGATG 3 cut(s) 121, 840, 1021
BseLI CCNNNNNNNGG 3 cut(s) 233, 396, 768
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 3 cut(s) 134, 390, 1017
BseXI GCAGC 3 cut(s) 238, 504, 928
BseYI CCCAGC 1 cut(s) 546
BshFI GGCC 1 cut(s) 237
BshNI GGYRCC 1 cut(s) 147
BsiSI CCGG 1 cut(s) 310
BslFI GGGAC 2 cut(s) 564, 1083
BslI CCNNNNNNNGG 3 cut(s) 233, 396, 768
BsmAI GTCTC 3 cut(s) 198, 290, 1035
BsmBI CGTCTC 2 cut(s) 198, 1035
BsmFI GGGAC 2 cut(s) 564, 1083
BsnI GGCC 1 cut(s) 237
Bsp143I GATC 1 cut(s) 415
BspANI GGCC 1 cut(s) 237
BspCNI CTCAG 1 cut(s) 49
BspLI GGNNCC 2 cut(s) 149, 838
BspQI GCTCTTC 1 cut(s) 666
BspT107I GGYRCC 1 cut(s) 147
BsrI ACTGG 3 cut(s) 134, 390, 1017
BssECI CCNNGG 4 cut(s) 152, 238, 512, 1052
BssMI GATC 1 cut(s) 415
BssT1I CCWWGG 3 cut(s) 152, 238, 1052
Bst2UI CCWGG 3 cut(s) 514, 625, 769
Bst4CI ACNGT 1 cut(s) 266
Bst6I CTCTTC 1 cut(s) 666
BstC8I GCNNGC 2 cut(s) 62, 962
BstDEI CTNAG 3 cut(s) 36, 634, 1104
BstF5I GGATG 3 cut(s) 121, 840, 1021
BstKTI GATC 1 cut(s) 418
BstMAI GTCTC 3 cut(s) 198, 290, 1035
BstMBI GATC 1 cut(s) 415
BstMWI GCNNNNNNNGC 6 cut(s) 206, 243, 629, 638, 721, 989
BstNI CCWGG 3 cut(s) 514, 625, 769
BstSCI CCNGG 3 cut(s) 512, 623, 767
BstSFI CTRYAG 3 cut(s) 6, 591, 996
BstV1I GCAGC 3 cut(s) 238, 504, 928
BstV2I GAAGAC 1 cut(s) 267
BsuRI GGCC 1 cut(s) 237
BtsCI GGATG 3 cut(s) 121, 840, 1021
BtsIMutI CAGTG 3 cut(s) 105, 141, 1005
Cac8I GCNNGC 2 cut(s) 62, 962
CseI GACGC 1 cut(s) 215
CsiI ACCWGGT 1 cut(s) 767
Csp6I GTAC 1 cut(s) 74
CviAII CATG 5 cut(s) 220, 573, 612, 698, 924
CviQI GTAC 1 cut(s) 74
DdeI CTNAG 3 cut(s) 36, 634, 1104
DpnI GATC 1 cut(s) 417
DpnII GATC 1 cut(s) 415
EaeI YGGCCR 1 cut(s) 235
Eam1104I CTCTTC 1 cut(s) 666
EarI CTCTTC 1 cut(s) 666
Eco130I CCWWGG 3 cut(s) 152, 238, 1052
EcoRII CCWGG 3 cut(s) 512, 623, 767
EcoT14I CCWWGG 3 cut(s) 152, 238, 1052
ErhI CCWWGG 3 cut(s) 152, 238, 1052
Esp3I CGTCTC 2 cut(s) 198, 1035
FaeI CATG 5 cut(s) 223, 576, 615, 701, 927
FalI AAGNNNNNCTT 2 cut(s) 845, 877
FaqI GGGAC 2 cut(s) 564, 1083
FatI CATG 5 cut(s) 219, 572, 611, 697, 923
FblI GTMKAC 2 cut(s) 5, 693
Fnu4HI GCNGC 3 cut(s) 252, 518, 917
FokI GGATG 3 cut(s) 128, 827, 1028
Fsp4HI GCNGC 3 cut(s) 252, 518, 917
FspBI CTAG 3 cut(s) 20, 756, 965
GluI GCNGC 3 cut(s) 252, 518, 917
GsaI CCCAGC 1 cut(s) 550
GsuI CTGGAG 2 cut(s) 117, 222
HaeIII GGCC 1 cut(s) 237
HapII CCGG 1 cut(s) 310
HgaI GACGC 1 cut(s) 215
Hin1II CATG 5 cut(s) 223, 576, 615, 701, 927
HincII GTYRAC 1 cut(s) 883
HindII GTYRAC 1 cut(s) 883
HindIII AAGCTT 1 cut(s) 815
HinfI GANTC 8 cut(s) 552, 569, 734, 800, 858, 879, 928, 973
HpaII CCGG 1 cut(s) 310
HphI GGTGA 1 cut(s) 302
Hpy166II GTNNAC 3 cut(s) 6, 694, 883
Hpy188I TCNGA 2 cut(s) 68, 420
Hpy188III TCNNGA 2 cut(s) 481, 977
Hpy8I GTNNAC 3 cut(s) 6, 694, 883
HpyAV CCTTC 1 cut(s) 523
HpyCH4III ACNGT 1 cut(s) 266
HpyCH4V TGCA 6 cut(s) 254, 715, 743, 896, 983, 1095
HpyF10VI GCNNNNNNNGC 6 cut(s) 206, 243, 629, 638, 721, 989
HpyF3I CTNAG 3 cut(s) 36, 634, 1104
Hsp92II CATG 5 cut(s) 223, 576, 615, 701, 927
Kzo9I GATC 1 cut(s) 415
LguI GCTCTTC 1 cut(s) 666
LmnI GCTCC 1 cut(s) 1100
Lsp1109I GCAGC 3 cut(s) 238, 504, 928
LweI GCATC 4 cut(s) 106, 646, 970, 1006
MabI ACCWGGT 1 cut(s) 767
MaeI CTAG 3 cut(s) 20, 756, 965
MalI GATC 1 cut(s) 417
MboI GATC 1 cut(s) 415
MboII GAAGA 7 cut(s) 37, 272, 316, 350, 538, 653, 809
MfeI CAATTG 1 cut(s) 938
MluCI AATT 6 cut(s) 110, 321, 382, 673, 938, 947
MlyI GAGTC 3 cut(s) 546, 867, 888
MmeI TCCRAC 2 cut(s) 546, 711
MseI TTAA 4 cut(s) 446, 813, 846, 852
MslI CAYNNNNRTG 1 cut(s) 134
MspI CCGG 1 cut(s) 310
MspR9I CCNGG 3 cut(s) 514, 625, 769
MunI CAATTG 1 cut(s) 938
MvaI CCWGG 3 cut(s) 514, 625, 769
MwoI GCNNNNNNNGC 6 cut(s) 206, 243, 629, 638, 721, 989
NdeII GATC 1 cut(s) 415
NlaIII CATG 5 cut(s) 223, 576, 615, 701, 927
NlaIV GGNNCC 2 cut(s) 149, 838
OliI CACNNNNGTG 1 cut(s) 134
PciSI GCTCTTC 1 cut(s) 666
PfeI GAWTC 5 cut(s) 569, 734, 800, 928, 973
PkrI GCNGC 3 cut(s) 253, 519, 918
PleI GAGTC 3 cut(s) 546, 866, 887
PpsI GAGTC 3 cut(s) 546, 866, 887
Psp6I CCWGG 3 cut(s) 512, 623, 767
PspFI CCCAGC 1 cut(s) 546
PspGI CCWGG 3 cut(s) 512, 623, 767
PspN4I GGNNCC 2 cut(s) 149, 838
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
RseI CAYNNNNRTG 1 cut(s) 134
SapI GCTCTTC 1 cut(s) 666
SaqAI TTAA 4 cut(s) 446, 813, 846, 852
SatI GCNGC 3 cut(s) 252, 518, 917
Sau3AI GATC 1 cut(s) 415
SchI GAGTC 3 cut(s) 546, 867, 888
ScrFI CCNGG 3 cut(s) 514, 625, 769
SexAI ACCWGGT 1 cut(s) 767
SfaNI GCATC 4 cut(s) 106, 646, 970, 1006
SfcI CTRYAG 3 cut(s) 6, 591, 996
SmiMI CAYNNNNRTG 1 cut(s) 134
SmlI CTYRAG 2 cut(s) 481, 1036
SmoI CTYRAG 2 cut(s) 481, 1036
Sse9I AATT 6 cut(s) 110, 321, 382, 673, 938, 947
SspI AATATT 1 cut(s) 175
SspMI CTAG 3 cut(s) 20, 756, 965
StyD4I CCNGG 3 cut(s) 512, 623, 767
StyI CCWWGG 3 cut(s) 152, 238, 1052
TaaI ACNGT 1 cut(s) 266
TaqI TCGA 2 cut(s) 555, 795
TasI AATT 6 cut(s) 110, 321, 382, 673, 938, 947
TfiI GAWTC 5 cut(s) 569, 734, 800, 928, 973
Tru1I TTAA 4 cut(s) 446, 813, 846, 852
Tru9I TTAA 4 cut(s) 446, 813, 846, 852
TscAI CASTG 3 cut(s) 112, 141, 1012
TseI GCWGC 3 cut(s) 251, 517, 916
TspDTI ATGAA 4 cut(s) 96, 351, 714, 762
TspRI CASTG 3 cut(s) 112, 141, 1012
XcmI CCANNNNNNNNNTGG 1 cut(s) 510
XmiI GTMKAC 2 cut(s) 5, 693
XspI CTAG 3 cut(s) 20, 756, 965
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.