RchiOBHm_Chr5g0035851

Phosphoenolpyruvate carboxylase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
29866905 .. 29868061
1157 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 408 bp
ATGCTGTCAAACTGTCTAGTCACAAAAGATGTCTCACTTTTATCTAGGTGGATGACTATTGATCTCTATATTCGAGAAGTGGATAGCCTGAAATTTGAACTATCCATGAATAGGTGCAGCGATATCTTGTCAAAACTGGCACAAGAGATTCTAGAACACTCAGAATCTGCATCTGAGGATCACCAAAGTTGGGATCATCAGTGTTATAATAGGAATCAGGTAAAGCAACAAGCTGCAACACTTCCAACACAACTTCCAGCTAGAGCTAATCAACCCTCTTGCACTGGTGAACATCCGATTATCCTCTTAAAACTACTTTTTAAAGAAAAAATTTATAATAAAATTGAGGATCTCGAAAGTTGTGTTACTTTTATATTATTTTCATATGCTGCCATCCTTATTGCATAA

Protein Analysis

135

Amino Acids

15.5

Weight (kDa)

5.51

Isoelectric Point (pI)

54.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PEPcase PF00311 7 - 78 5.5e-06 Phosphoenolpyruvate carboxylase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 207, 336
AclWI GGATC 3 cut(s) 186, 201, 357
AcsI RAATTY 2 cut(s) 92, 330
AfiI CCNNNNNNNGG 2 cut(s) 111, 190
AgsI TTSAA 1 cut(s) 98
AluBI AGCT 3 cut(s) 233, 260, 266
AluI AGCT 3 cut(s) 233, 260, 266
Alw26I GTCTC 1 cut(s) 37
AlwI GGATC 3 cut(s) 186, 201, 357
AlwNI CAGNNNCTG 1 cut(s) 167
ApeKI GCWGC 3 cut(s) 117, 233, 389
ApoI RAATTY 2 cut(s) 92, 330
AsuHPI GGTGA 2 cut(s) 173, 299
BbvI GCAGC 3 cut(s) 129, 220, 376
BccI CCATC 1 cut(s) 401
BcoDI GTCTC 1 cut(s) 37
BfaI CTAG 4 cut(s) 17, 45, 152, 261
BisI GCNGC 3 cut(s) 118, 234, 390
BlsI GCNGC 3 cut(s) 119, 235, 391
BmsI GCATC 1 cut(s) 179
Bsc4I CCNNNNNNNGG 2 cut(s) 111, 190
Bse1I ACTGG 2 cut(s) 141, 289
BseGI GGATG 3 cut(s) 57, 292, 393
BseLI CCNNNNNNNGG 2 cut(s) 111, 190
BseMII CTCAG 2 cut(s) 165, 174
BseNI ACTGG 2 cut(s) 141, 289
BseXI GCAGC 3 cut(s) 129, 220, 376
BsgI GTGCAG 1 cut(s) 136
BslI CCNNNNNNNGG 2 cut(s) 111, 190
BsmAI GTCTC 1 cut(s) 37
Bsp143I GATC 4 cut(s) 61, 178, 193, 349
BspCNI CTCAG 2 cut(s) 166, 173
BspPI GGATC 3 cut(s) 186, 201, 357
BsrI ACTGG 2 cut(s) 141, 289
BssMI GATC 4 cut(s) 61, 178, 193, 349
Bst4CI ACNGT 1 cut(s) 14
BstDEI CTNAG 2 cut(s) 160, 174
BstF5I GGATG 3 cut(s) 57, 292, 393
BstKTI GATC 4 cut(s) 64, 181, 196, 352
BstMAI GTCTC 1 cut(s) 37
BstMBI GATC 4 cut(s) 61, 178, 193, 349
BstV1I GCAGC 3 cut(s) 129, 220, 376
BstX2I RGATCY 1 cut(s) 349
BstYI RGATCY 1 cut(s) 349
BtsCI GGATG 3 cut(s) 57, 292, 393
BtsIMutI CAGTG 2 cut(s) 206, 282
CaiI CAGNNNCTG 1 cut(s) 167
CviAII CATG 1 cut(s) 106
CviJI RGCY 4 cut(s) 87, 233, 260, 266
CviKI_1 RGCY 4 cut(s) 87, 233, 260, 266
DdeI CTNAG 2 cut(s) 160, 174
DpnI GATC 4 cut(s) 63, 180, 195, 351
DpnII GATC 4 cut(s) 61, 178, 193, 349
DraI TTTAAA 1 cut(s) 322
Eco32I GATATC 1 cut(s) 124
EcoRV GATATC 1 cut(s) 124
FaeI CATG 1 cut(s) 109
FaiI YATR 8 cut(s) 69, 107, 207, 336, 374, 385, 387, 406
FatI CATG 1 cut(s) 105
FauNDI CATATG 1 cut(s) 385
Fnu4HI GCNGC 3 cut(s) 118, 234, 390
FokI GGATG 3 cut(s) 64, 279, 380
Fsp4HI GCNGC 3 cut(s) 118, 234, 390
FspBI CTAG 4 cut(s) 17, 45, 152, 261
GluI GCNGC 3 cut(s) 118, 234, 390
Hin1II CATG 1 cut(s) 109
HinfI GANTC 3 cut(s) 148, 164, 214
HphI GGTGA 2 cut(s) 173, 299
Hpy166II GTNNAC 1 cut(s) 290
Hpy188I TCNGA 3 cut(s) 163, 175, 297
Hpy188III TCNNGA 3 cut(s) 74, 152, 353
Hpy8I GTNNAC 1 cut(s) 290
HpyCH4III ACNGT 1 cut(s) 14
HpyCH4V TGCA 5 cut(s) 117, 170, 236, 282, 404
HpyF3I CTNAG 2 cut(s) 160, 174
Hsp92II CATG 1 cut(s) 109
Kzo9I GATC 4 cut(s) 61, 178, 193, 349
LpnPI CCDG 5 cut(s) 101, 122, 203, 270, 270
Lsp1109I GCAGC 3 cut(s) 129, 220, 376
LweI GCATC 1 cut(s) 179
MaeI CTAG 4 cut(s) 17, 45, 152, 261
MaeIII GTNAC 2 cut(s) 19, 364
MalI GATC 4 cut(s) 63, 180, 195, 351
MboI GATC 4 cut(s) 61, 178, 193, 349
MflI RGATCY 1 cut(s) 349
MluCI AATT 3 cut(s) 92, 330, 342
MmeI TCCRAC 1 cut(s) 269
MnlI CCTC 4 cut(s) 169, 286, 314, 340
MseI TTAA 2 cut(s) 308, 321
NdeI CATATG 1 cut(s) 385
NdeII GATC 4 cut(s) 61, 178, 193, 349
NlaIII CATG 1 cut(s) 109
NmuCI GTSAC 1 cut(s) 19
PfeI GAWTC 3 cut(s) 148, 164, 214
PkrI GCNGC 3 cut(s) 119, 235, 391
PsiI TTATAA 2 cut(s) 207, 336
PstNI CAGNNNCTG 1 cut(s) 167
PsuI RGATCY 1 cut(s) 349
SaqAI TTAA 2 cut(s) 308, 321
SatI GCNGC 3 cut(s) 118, 234, 390
Sau3AI GATC 4 cut(s) 61, 178, 193, 349
SetI ASST 6 cut(s) 50, 116, 222, 235, 262, 268
SfaNI GCATC 1 cut(s) 179
Sse9I AATT 3 cut(s) 92, 330, 342
SspMI CTAG 4 cut(s) 17, 45, 152, 261
TaaI ACNGT 1 cut(s) 14
TaqI TCGA 2 cut(s) 73, 354
TasI AATT 3 cut(s) 92, 330, 342
TfiI GAWTC 3 cut(s) 148, 164, 214
Tru1I TTAA 2 cut(s) 308, 321
Tru9I TTAA 2 cut(s) 308, 321
TscAI CASTG 2 cut(s) 206, 289
TseFI GTSAC 1 cut(s) 19
TseI GCWGC 3 cut(s) 117, 233, 389
Tsp45I GTSAC 1 cut(s) 19
TspDTI ATGAA 2 cut(s) 122, 372
TspRI CASTG 2 cut(s) 206, 289
XapI RAATTY 2 cut(s) 92, 330
XbaI TCTAGA 1 cut(s) 151
XspI CTAG 4 cut(s) 17, 45, 152, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.