RchiOBHm_Chr2g0135881

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
53075796 .. 53078470
2675 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50671

Sequence Viewer

Length: 144 bp
ATGTGGAGACTACCAAAGCATAGCTTCCATTGTTTTTCTTTGACAATTTCCTTTACAGAATGCAATGGTGGTCATTCTCACTATCCCAGAATTGAAATGTTGGTCATTTTAACTGAAGATTGCATTGGGGCAGGAATCTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.44

Weight (kDa)

6.37

Isoelectric Point (pI)

55.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 135
AgsI TTSAA 1 cut(s) 95
AjuI GAANNNNNNNTTGG 2 cut(s) 108, 140
AluBI AGCT 1 cut(s) 24
AluI AGCT 1 cut(s) 24
Bse3DI GCAATG 1 cut(s) 70
BseMI GCAATG 1 cut(s) 70
BsmI GAATGC 1 cut(s) 65
BsrDI GCAATG 1 cut(s) 70
CviJI RGCY 1 cut(s) 24
CviKI_1 RGCY 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 135
FaiI YATR 1 cut(s) 21
FalI AAGNNNNNCTT 2 cut(s) 8, 40
HinfI GANTC 1 cut(s) 135
HpyCH4V TGCA 2 cut(s) 63, 123
LpnPI CCDG 3 cut(s) 100, 117, 124
MboII GAAGA 1 cut(s) 128
MluCI AATT 2 cut(s) 45, 90
MseI TTAA 1 cut(s) 110
Mva1269I GAATGC 1 cut(s) 65
PctI GAATGC 1 cut(s) 65
PfeI GAWTC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 110
SetI ASST 1 cut(s) 26
SgeI CNNG 1 cut(s) 99
Sse9I AATT 2 cut(s) 45, 90
TasI AATT 2 cut(s) 45, 90
TfiI GAWTC 1 cut(s) 135
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.