RchiOBHm_Chr4g0407131

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
29261906 .. 29262544
639 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37840

Sequence Viewer

Length: 123 bp
ATGTGGAGACTACCAAAGCATAGCTTCCATTGTTTTTCTTTGACAATTTCCTTAACAGAATCTGCATCTGAGGATCACCAGAGTTGGGATCATCAGTGTTATAATAGGAATCAGGTAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

40

Amino Acids

4.85

Weight (kDa)

6.89

Isoelectric Point (pI)

41.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 102
AclWI GGATC 2 cut(s) 81, 96
AfiI CCNNNNNNNGG 1 cut(s) 85
AluBI AGCT 1 cut(s) 24
AluI AGCT 1 cut(s) 24
AlwI GGATC 2 cut(s) 81, 96
AlwNI CAGNNNCTG 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 68
BmsI GCATC 1 cut(s) 74
Bsc4I CCNNNNNNNGG 1 cut(s) 85
BseLI CCNNNNNNNGG 1 cut(s) 85
BseMII CTCAG 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 85
Bsp143I GATC 2 cut(s) 73, 88
BspCNI CTCAG 1 cut(s) 61
BspPI GGATC 2 cut(s) 81, 96
BssMI GATC 2 cut(s) 73, 88
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 2 cut(s) 76, 91
BstMBI GATC 2 cut(s) 73, 88
BtsIMutI CAGTG 1 cut(s) 101
CaiI CAGNNNCTG 1 cut(s) 62
CviJI RGCY 1 cut(s) 24
CviKI_1 RGCY 1 cut(s) 24
DdeI CTNAG 1 cut(s) 69
DpnI GATC 2 cut(s) 75, 90
DpnII GATC 2 cut(s) 73, 88
FaiI YATR 2 cut(s) 21, 102
FalI AAGNNNNNCTT 2 cut(s) 8, 40
FspEI CC 9 cut(s) 27, 41, 56, 64, 70, 71, 91, 92, 98
HinfI GANTC 2 cut(s) 59, 109
HphI GGTGA 1 cut(s) 68
Hpy188I TCNGA 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 69
Kzo9I GATC 2 cut(s) 73, 88
LpnPI CCDG 2 cut(s) 92, 98
LweI GCATC 1 cut(s) 74
MalI GATC 2 cut(s) 75, 90
MboI GATC 2 cut(s) 73, 88
MluCI AATT 1 cut(s) 45
MnlI CCTC 1 cut(s) 64
MseI TTAA 1 cut(s) 53
NdeII GATC 2 cut(s) 73, 88
PfeI GAWTC 2 cut(s) 59, 109
PsiI TTATAA 1 cut(s) 102
PstNI CAGNNNCTG 1 cut(s) 62
SaqAI TTAA 1 cut(s) 53
Sau3AI GATC 2 cut(s) 73, 88
SetI ASST 2 cut(s) 26, 117
SfaNI GCATC 1 cut(s) 74
SgeI CNNG 1 cut(s) 91
Sse9I AATT 1 cut(s) 45
TasI AATT 1 cut(s) 45
TfiI GAWTC 2 cut(s) 59, 109
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TscAI CASTG 1 cut(s) 101
TspRI CASTG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.