RchiOBHm_Chr4g0387391

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
2560883 .. 2561134
252 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGGCTAAAGGTCTCTTACAACCTGAAAATAAGAGAATGTTGAAAGAAGTTGGAAATGAGTACTTTGATGATCTACTCTCAAGTACATTTCTTCAACATCCATATGGCAACTATTTCATCATGCACGACCTTATCAGTGATTTGGCAAAGTTTATACCTGGAGAATTCTGTGTTAGACTGGAGGACAACGCCTCACCCAACATTATGAGCAAGACACGCCATTTTTCATATATGAAAGCAAAAATATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.63

Weight (kDa)

6.82

Isoelectric Point (pI)

57.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 1 - 49 5.7e-13 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020537)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0387391
rosa_laevigata RLG00000018080 RLG00000018082
rosa_multiflora Rmu_sc0004283.1_g000014 Rmu_sc0009639.1_g000004
rosa_rugosa Rorug02G0188900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 164
AfaI GTAC 2 cut(s) 62, 85
AgsI TTSAA 2 cut(s) 43, 95
AjnI CCWGG 1 cut(s) 157
Alw26I GTCTC 1 cut(s) 17
ApoI RAATTY 1 cut(s) 164
AsuHPI GGTGA 1 cut(s) 186
BciT130I CCWGG 1 cut(s) 159
BcoDI GTCTC 1 cut(s) 17
BmcAI AGTACT 1 cut(s) 62
Bme1390I CCNGG 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 159
BpmI CTGGAG 2 cut(s) 180, 200
BpuEI CTTGAG 1 cut(s) 64
BsaI GGTCTC 1 cut(s) 17
Bse1I ACTGG 1 cut(s) 183
BseBI CCWGG 1 cut(s) 159
BseGI GGATG 1 cut(s) 97
BseNI ACTGG 1 cut(s) 183
BsmAI GTCTC 1 cut(s) 17
Bso31I GGTCTC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 70
BspHI TCATGA 1 cut(s) 248
BspTNI GGTCTC 1 cut(s) 17
BsrI ACTGG 1 cut(s) 183
BssMI GATC 1 cut(s) 70
Bst2UI CCWGG 1 cut(s) 159
BstF5I GGATG 1 cut(s) 97
BstKTI GATC 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 17
BstMBI GATC 1 cut(s) 70
BstMWI GCNNNNNNNGC 1 cut(s) 216
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BtsCI GGATG 1 cut(s) 97
BtsIMutI CAGTG 1 cut(s) 142
CciI TCATGA 1 cut(s) 248
Csp6I GTAC 2 cut(s) 61, 84
CviAII CATG 2 cut(s) 121, 249
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 2 cut(s) 61, 84
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eco31I GGTCTC 1 cut(s) 17
EcoRI GAATTC 1 cut(s) 164
EcoRII CCWGG 1 cut(s) 157
FaeI CATG 2 cut(s) 124, 252
FaiI YATR 9 cut(s) 103, 105, 122, 155, 206, 229, 231, 233, 250
FatI CATG 2 cut(s) 120, 248
FauNDI CATATG 1 cut(s) 103
FokI GGATG 1 cut(s) 84
GsuI CTGGAG 2 cut(s) 180, 200
Hin1II CATG 2 cut(s) 124, 252
HphI GGTGA 1 cut(s) 186
Hpy188III TCNNGA 1 cut(s) 249
HpyCH4V TGCA 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 1 cut(s) 216
Hsp92II CATG 2 cut(s) 124, 252
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 4 cut(s) 36, 144, 164, 171
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 1 cut(s) 83
MluCI AATT 1 cut(s) 164
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 2 cut(s) 175, 202
MslI CAYNNNNRTG 1 cut(s) 102
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
MwoI GCNNNNNNNGC 1 cut(s) 216
NdeI CATATG 1 cut(s) 103
NdeII GATC 1 cut(s) 70
NlaIII CATG 2 cut(s) 124, 252
PagI TCATGA 1 cut(s) 248
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
RsaI GTAC 2 cut(s) 62, 85
RsaNI GTAC 2 cut(s) 61, 84
RseI CAYNNNNRTG 1 cut(s) 102
Sau3AI GATC 1 cut(s) 70
ScaI AGTACT 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 159
SetI ASST 4 cut(s) 13, 25, 132, 160
SgeI CNNG 9 cut(s) 35, 93, 133, 137, 170, 171, 191, 223, 228
SmiMI CAYNNNNRTG 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
Sse9I AATT 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 157
TasI AATT 1 cut(s) 164
TatI WGTACW 2 cut(s) 60, 83
TscAI CASTG 1 cut(s) 142
TspDTI ATGAA 3 cut(s) 106, 216, 248
TspRI CASTG 1 cut(s) 142
XapI RAATTY 1 cut(s) 164
ZrmI AGTACT 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.