RchiOBHm_Chr3g0490481

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
37112947 .. 37113604
658 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 132 bp
ATGGGTCCTAGTGTGAATGGAGATTATGGGTCATATCGGCAATCAGAAAGAAATTCTTTGTACAAGCAATATGCTGAGAAGCTTTTAGAGTGTGGTTATGTTTTTGCTGCTTTTGCTCTAGTGAGGAACTAG

Protein Analysis

43

Amino Acids

4.9

Weight (kDa)

7.87

Isoelectric Point (pI)

45.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018138)

Species Orthologous Gene IDs
pyrus_communis pycom10g00740
rosa_chinensis RchiOBHm_Chr3g0490481
rosa_laevigata RLG00000022888
rosa_multiflora Rmu_sc0000375.1_g000009
rosa_roxburghii Rroxscaffold_5G00358670
rosa_samantha Rh1AG237900 Rh3AG293100 Rh3CG327200 Rh4AG027400 Rh5AG387000
rosa_wichuraiana Rw5G036410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 52
AfaI GTAC 1 cut(s) 62
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
ApeKI GCWGC 1 cut(s) 107
ApoI RAATTY 1 cut(s) 52
AspS9I GGNCC 1 cut(s) 5
AvaII GGWCC 1 cut(s) 5
BbvI GCAGC 1 cut(s) 94
BfaI CTAG 3 cut(s) 9, 119, 130
BisI GCNGC 1 cut(s) 108
BlsI GCNGC 1 cut(s) 109
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 1 cut(s) 6
BseMII CTCAG 1 cut(s) 66
BseXI GCAGC 1 cut(s) 94
Bsp1407I TGTACA 1 cut(s) 60
BspCNI CTCAG 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 6
BsrGI TGTACA 1 cut(s) 60
BstAUI TGTACA 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 75
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstV1I GCAGC 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 5
Csp6I GTAC 1 cut(s) 61
CviJI RGCY 1 cut(s) 82
CviKI_1 RGCY 1 cut(s) 82
CviQI GTAC 1 cut(s) 61
DdeI CTNAG 1 cut(s) 75
Eco47I GGWCC 1 cut(s) 5
EcoO109I RGGNCCY 1 cut(s) 5
FaiI YATR 4 cut(s) 27, 34, 72, 99
FalI AAGNNNNNCTT 2 cut(s) 40, 72
Fnu4HI GCNGC 1 cut(s) 108
Fsp4HI GCNGC 1 cut(s) 108
FspBI CTAG 3 cut(s) 9, 119, 130
FspEI CC 7 cut(s) 3, 12, 13, 21, 22, 78, 109
GluI GCNGC 1 cut(s) 108
HindIII AAGCTT 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 46
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 1 cut(s) 75
Lsp1109I GCAGC 1 cut(s) 94
MaeI CTAG 3 cut(s) 9, 119, 130
MluCI AATT 1 cut(s) 52
MnlI CCTC 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 113
NlaIV GGNNCC 1 cut(s) 6
PkrI GCNGC 1 cut(s) 109
PpuMI RGGWCCY 1 cut(s) 5
Psp5II RGGWCCY 1 cut(s) 5
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 5
PspPPI RGGWCCY 1 cut(s) 5
RsaI GTAC 1 cut(s) 62
RsaNI GTAC 1 cut(s) 61
SatI GCNGC 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 5
SetI ASST 1 cut(s) 84
SgeI CNNG 2 cut(s) 21, 76
SinI GGWCC 1 cut(s) 5
Sse9I AATT 1 cut(s) 52
SspMI CTAG 3 cut(s) 9, 119, 130
TasI AATT 1 cut(s) 52
TatI WGTACW 1 cut(s) 60
TseI GCWGC 1 cut(s) 107
VpaK11BI GGWCC 1 cut(s) 5
XapI RAATTY 1 cut(s) 52
XspI CTAG 3 cut(s) 9, 119, 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.