RchiOBHm_Chr2g0096161

trafficking protein particle complex

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
9032582 .. 9036477
3896 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGGGTGATTATTGCATGTTGGCAGGATCACAGGTTGATACCAATCTTCATTACTTTGCTGCACTAGAACTTTCTAGGTTGACTGGAGATTTTTTCTGGTATGCTGGTGCATTGGAGGGGAGCGTTTGTTTATTACCGATTCCATTTGAAGGAGTGTAG

Protein Analysis

52

Amino Acids

5.69

Weight (kDa)

4.05

Isoelectric Point (pI)

32.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018942)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 34
AfiI CCNNNNNNNGG 1 cut(s) 149
AgsI TTSAA 1 cut(s) 149
AlwI GGATC 1 cut(s) 34
ApeKI GCWGC 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 17
BbvI GCAGC 1 cut(s) 46
BfaI CTAG 2 cut(s) 65, 75
BisI GCNGC 1 cut(s) 60
BlsI GCNGC 1 cut(s) 61
BpmI CTGGAG 1 cut(s) 105
BsaBI GATNNNNATC 1 cut(s) 42
BsaXI ACNNNNNCTCC 2 cut(s) 112, 142
Bsc4I CCNNNNNNNGG 1 cut(s) 149
Bse1I ACTGG 1 cut(s) 88
Bse8I GATNNNNATC 1 cut(s) 42
BseJI GATNNNNATC 1 cut(s) 42
BseLI CCNNNNNNNGG 1 cut(s) 149
BseNI ACTGG 1 cut(s) 88
BseXI GCAGC 1 cut(s) 46
BsgI GTGCAG 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 149
Bsp143I GATC 1 cut(s) 26
BspPI GGATC 1 cut(s) 34
BsrI ACTGG 1 cut(s) 88
BssMI GATC 1 cut(s) 26
BstKTI GATC 1 cut(s) 29
BstMBI GATC 1 cut(s) 26
BstNSI RCATGY 1 cut(s) 19
BstV1I GCAGC 1 cut(s) 46
CviAII CATG 1 cut(s) 16
DpnI GATC 1 cut(s) 28
DpnII GATC 1 cut(s) 26
FaeI CATG 1 cut(s) 19
FaiI YATR 2 cut(s) 17, 102
FatI CATG 1 cut(s) 15
Fnu4HI GCNGC 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 60
FspBI CTAG 2 cut(s) 65, 75
GluI GCNGC 1 cut(s) 60
GsuI CTGGAG 1 cut(s) 105
Hin1II CATG 1 cut(s) 19
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HinfI GANTC 1 cut(s) 139
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 81
Hpy8I GTNNAC 1 cut(s) 81
HpyAV CCTTC 1 cut(s) 143
HpyCH4V TGCA 3 cut(s) 15, 62, 110
Hsp92II CATG 1 cut(s) 19
Kzo9I GATC 1 cut(s) 26
LmnI GCTCC 1 cut(s) 120
LpnPI CCDG 5 cut(s) 9, 17, 69, 82, 90
Lsp1109I GCAGC 1 cut(s) 46
MaeI CTAG 2 cut(s) 65, 75
MalI GATC 1 cut(s) 28
MboI GATC 1 cut(s) 26
MboII GAAGA 1 cut(s) 38
MnlI CCTC 1 cut(s) 109
NdeII GATC 1 cut(s) 26
NlaIII CATG 1 cut(s) 19
NspI RCATGY 1 cut(s) 19
PfeI GAWTC 1 cut(s) 139
PkrI GCNGC 1 cut(s) 61
SatI GCNGC 1 cut(s) 60
Sau3AI GATC 1 cut(s) 26
SetI ASST 2 cut(s) 36, 80
SgeI CNNG 8 cut(s) 28, 36, 44, 77, 87, 96, 109, 117
SspMI CTAG 2 cut(s) 65, 75
TfiI GAWTC 1 cut(s) 139
TseI GCWGC 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 38
XceI RCATGY 1 cut(s) 19
XspI CTAG 2 cut(s) 65, 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.