Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0018554

Physical Location & Seq

Genomic Coordinates Forward (+)

16305380 .. 16306391

Gene Structure 1012 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 174 bp

ATGTTCATACTCGCTCCTTTGAGTATGGGTTTTGGGATCGGCAACCTAGACGGAGAAGCAACCGCAAACCCTTTCTATCTGTTAGGCGATGACGATAACGATGACTTAATTCAACTTGCTGCTATGATGGTGGTTCCTGCTGCCACCCAGCCCAAGCCATTTTCAACGTGCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HABP4_PAI-RBP1 Stm1_N

Protein Analysis

57

Amino Acids

6.02

Weight (kDa)

4.05

Isoelectric Point (pI)

31.24

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Stm1_N	PF09598	20 - 51	4.4e-06	Stm1

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018554)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0327461
rosa_multiflora	Rmu_co8142420.1_g000001 Rmu_sc0005767.1_g000003
rosa_roxburghii	Rroxscaffold_3G00240360
rosa_rugosa	Rorug07G0349900
rosa_samantha	Rh3CG267900 Rh4AG009400 Rh4CG209600 Rh5AG322800 Rh5DG558800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	63
AclWI	GGATC	1 cut(s)	44
AgsI	TTSAA	2 cut(s)	113, 165
AlwI	GGATC	1 cut(s)	44
ApeKI	GCWGC	2 cut(s)	119, 140
BbvI	GCAGC	2 cut(s)	106, 127
BccI	CCATC	1 cut(s)	121
BfaI	CTAG	1 cut(s)	47
BisI	GCNGC	2 cut(s)	120, 141
BlsI	GCNGC	2 cut(s)	121, 142
BmiI	GGNNCC	1 cut(s)	135
BseXI	GCAGC	2 cut(s)	106, 127
BseYI	CCCAGC	1 cut(s)	147
Bsp143I	GATC	1 cut(s)	36
BspACI	CCGC	1 cut(s)	63
BspLI	GGNNCC	1 cut(s)	135
BspPI	GGATC	1 cut(s)	44
BssMI	GATC	1 cut(s)	36
BstKTI	GATC	1 cut(s)	39
BstMBI	GATC	1 cut(s)	36
BstV1I	GCAGC	2 cut(s)	106, 127
BtgZI	GCGATG	1 cut(s)	102
CviJI	RGCY	2 cut(s)	151, 157
CviKI_1	RGCY	2 cut(s)	151, 157
DpnI	GATC	1 cut(s)	38
DpnII	GATC	1 cut(s)	36
FaiI	YATR	3 cut(s)	8, 26, 125
Fnu4HI	GCNGC	2 cut(s)	120, 141
Fsp4HI	GCNGC	2 cut(s)	120, 141
FspBI	CTAG	1 cut(s)	47
GluI	GCNGC	2 cut(s)	120, 141
GsaI	CCCAGC	1 cut(s)	151
HpyCH4IV	ACGT	1 cut(s)	167
HpySE526I	ACGT	1 cut(s)	167
Kzo9I	GATC	1 cut(s)	36
LmnI	GCTCC	1 cut(s)	19
LpnPI	CCDG	2 cut(s)	150, 161
Lsp1109I	GCAGC	2 cut(s)	106, 127
MaeI	CTAG	1 cut(s)	47
MaeII	ACGT	1 cut(s)	167
MalI	GATC	1 cut(s)	38
MboI	GATC	1 cut(s)	36
MluCI	AATT	1 cut(s)	108
MseI	TTAA	1 cut(s)	107
NdeII	GATC	1 cut(s)	36
NlaIV	GGNNCC	1 cut(s)	135
PkrI	GCNGC	2 cut(s)	121, 142
PspFI	CCCAGC	1 cut(s)	147
PspN4I	GGNNCC	1 cut(s)	135
SaqAI	TTAA	1 cut(s)	107
SatI	GCNGC	2 cut(s)	120, 141
Sau3AI	GATC	1 cut(s)	36
SetI	ASST	2 cut(s)	48, 170
SgeI	CNNG	6 cut(s)	23, 59, 128, 149, 160, 166
Sse9I	AATT	1 cut(s)	108
SsiI	CCGC	1 cut(s)	63
SspMI	CTAG	1 cut(s)	47
TaiI	ACGT	1 cut(s)	170
TasI	AATT	1 cut(s)	108
Tru1I	TTAA	1 cut(s)	107
Tru9I	TTAA	1 cut(s)	107
TseI	GCWGC	2 cut(s)	119, 140
TspGWI	ACGGA	1 cut(s)	66
XspI	CTAG	1 cut(s)	47

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.