Rmu_sc0005767.1_g000003

Plasminogen activator inhibitor 1 RNA-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005767.1
OG0018554
Physical Location & Seq
Reverse (-)
15471 .. 19111
3641 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005767.1_g000003.1.cds

Sequence Viewer

Length: 618 bp
atgttcatacttgctcctccgagtataggttttgggatcaacaacctagaagcagaagcaactgcgaaccctttcgatttgttaggcgatgacgacaacgacgacttaagtcaacttgctgctatggtggtggttcctgctgccgcccagcccaaggtgttttcagctttaccaaacacatcagctgcttcttctcgcagcaatatcagaagtgcttcttctcgcagcaacatcagaagtgcttcttctcgcagcacagcaatcccaaactgggccaaggttagtgacttggtgccaagattttctatttctgatcagaggcaatgcgaacttctagtgaatctgcagcttgctcaagagcccaaaaccgcccgaaagcaggaggcccaaaaggcccgtcgttgtacaaaacagttagatcaagaattgatgagtgatgttggttcttgtccggccagatttagtgccactgttaatgccgctcctagtgcagctgctaataccgagaatgagaatagagaagaacaagctaatgtggcaatttggtggctttcattttattttattttttggggtcaaagcggtggttttgcttgtcaagatagatatgctacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HABP4_PAI-RBP1 Stm1_N

Protein Analysis

205

Amino Acids

22.26

Weight (kDa)

5.26

Isoelectric Point (pI)

68.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018554)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0327461
rosa_multiflora Rmu_co8142420.1_g000001 Rmu_sc0005767.1_g000003
rosa_roxburghii Rroxscaffold_3G00240360
rosa_rugosa Rorug07G0349900
rosa_samantha Rh3CG267900 Rh4AG009400 Rh4CG209600 Rh5AG322800 Rh5DG558800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 292
AccBSI CCGCTC 1 cut(s) 482
AciI CCGC 4 cut(s) 144, 369, 480, 582
AclWI GGATC 1 cut(s) 44
AcoI YGGCCR 1 cut(s) 453
AfaI GTAC 1 cut(s) 406
AfiI CCNNNNNNNGG 4 cut(s) 26, 154, 271, 379
AflII CTTAAG 1 cut(s) 106
AluBI AGCT 5 cut(s) 167, 185, 349, 494, 530
AluI AGCT 5 cut(s) 167, 185, 349, 494, 530
AlwI GGATC 1 cut(s) 44
AoxI GGCC 4 cut(s) 273, 384, 393, 453
ApeKI GCWGC 9 cut(s) 119, 140, 185, 198, 225, 252, 346, 491, 494
ArsI GACNNNNNNTTYG 2 cut(s) 382, 414
Asp700I GAANNNNTTC 3 cut(s) 71, 214, 241
AspS9I GGNCC 3 cut(s) 273, 385, 394
BanI GGYRCC 1 cut(s) 292
BanII GRGCYC 1 cut(s) 363
BbvI GCAGC 9 cut(s) 106, 127, 172, 210, 237, 264, 358, 481, 503
BclI TGATCA 1 cut(s) 313
BfaI CTAG 3 cut(s) 47, 335, 486
BfmI CTRYAG 1 cut(s) 344
BfrI CTTAAG 1 cut(s) 106
BglI GCCNNNNNGGC 1 cut(s) 392
BmgT120I GGNCC 3 cut(s) 273, 385, 394
BmiI GGNNCC 2 cut(s) 135, 294
BmrI ACTGGG 1 cut(s) 280
BmuI ACTGGG 1 cut(s) 280
BoxI GACNNNNGTC 1 cut(s) 108
BpuEI CTTGAG 1 cut(s) 339
BsaJI CCNNGG 2 cut(s) 153, 276
Bsc4I CCNNNNNNNGG 4 cut(s) 26, 154, 271, 379
Bse1I ACTGG 1 cut(s) 275
Bse3DI GCAATG 1 cut(s) 329
BseDI CCNNGG 2 cut(s) 153, 276
BseLI CCNNNNNNNGG 4 cut(s) 26, 154, 271, 379
BseMI GCAATG 1 cut(s) 329
BseNI ACTGG 1 cut(s) 275
BseRI GAGGAG 1 cut(s) 6
BseXI GCAGC 9 cut(s) 106, 127, 172, 210, 237, 264, 358, 481, 503
BseYI CCCAGC 1 cut(s) 147
BsgI GTGCAG 1 cut(s) 510
BshFI GGCC 4 cut(s) 275, 386, 395, 455
BshNI GGYRCC 1 cut(s) 292
BsiSI CCGG 1 cut(s) 452
BslI CCNNNNNNNGG 4 cut(s) 26, 154, 271, 379
BsnI GGCC 4 cut(s) 275, 386, 395, 455
Bsp1286I GDGCHC 1 cut(s) 363
Bsp1407I TGTACA 1 cut(s) 404
Bsp143I GATC 3 cut(s) 36, 313, 418
BspACI CCGC 4 cut(s) 144, 369, 480, 582
BspANI GGCC 4 cut(s) 275, 386, 395, 455
BspLI GGNNCC 2 cut(s) 135, 294
BspMAI CTGCAG 1 cut(s) 348
BspPI GGATC 1 cut(s) 44
BspT107I GGYRCC 1 cut(s) 292
BspTI CTTAAG 1 cut(s) 106
BsrBI CCGCTC 1 cut(s) 482
BsrDI GCAATG 1 cut(s) 329
BsrGI TGTACA 1 cut(s) 404
BsrI ACTGG 1 cut(s) 275
BssECI CCNNGG 2 cut(s) 153, 276
BssMI GATC 3 cut(s) 36, 313, 418
BssT1I CCWWGG 2 cut(s) 153, 276
Bst4CI ACNGT 2 cut(s) 414, 472
BstAFI CTTAAG 1 cut(s) 106
BstAUI TGTACA 1 cut(s) 404
BstC8I GCNNGC 1 cut(s) 351
BstKTI GATC 3 cut(s) 39, 316, 421
BstMBI GATC 3 cut(s) 36, 313, 418
BstMWI GCNNNNNNNGC 3 cut(s) 392, 488, 536
BstPAI GACNNNNGTC 1 cut(s) 108
BstSFI CTRYAG 1 cut(s) 344
BstV1I GCAGC 9 cut(s) 106, 127, 172, 210, 237, 264, 358, 481, 503
BsuRI GGCC 4 cut(s) 275, 386, 395, 455
BtgZI GCGATG 1 cut(s) 102
BtsIMutI CAGTG 1 cut(s) 468
Cac8I GCNNGC 1 cut(s) 351
Cfr13I GGNCC 3 cut(s) 273, 385, 394
Csp6I GTAC 1 cut(s) 405
CviQI GTAC 1 cut(s) 405
DpnI GATC 3 cut(s) 38, 315, 420
DpnII GATC 3 cut(s) 36, 313, 418
EaeI YGGCCR 1 cut(s) 453
Eco130I CCWWGG 2 cut(s) 153, 276
Eco24I GRGCYC 1 cut(s) 363
EcoT14I CCWWGG 2 cut(s) 153, 276
EcoT38I GRGCYC 1 cut(s) 363
ErhI CCWWGG 2 cut(s) 153, 276
FaiI YATR 4 cut(s) 8, 26, 125, 609
FalI AAGNNNNNCTT 4 cut(s) 202, 234, 229, 261
FbaI TGATCA 1 cut(s) 313
FriOI GRGCYC 1 cut(s) 363
FspBI CTAG 3 cut(s) 47, 335, 486
GsaI CCCAGC 1 cut(s) 151
HaeIII GGCC 4 cut(s) 275, 386, 395, 455
HapII CCGG 1 cut(s) 452
HincII GTYRAC 1 cut(s) 113
HindII GTYRAC 1 cut(s) 113
HinfI GANTC 1 cut(s) 340
HpaII CCGG 1 cut(s) 452
Hpy166II GTNNAC 1 cut(s) 113
Hpy188I TCNGA 5 cut(s) 21, 209, 236, 313, 318
Hpy188III TCNNGA 3 cut(s) 356, 422, 599
Hpy8I GTNNAC 1 cut(s) 113
Hpy99I CGWCG 2 cut(s) 104, 402
HpyCH4III ACNGT 2 cut(s) 414, 472
HpyCH4V TGCA 2 cut(s) 346, 491
HpyF10VI GCNNNNNNNGC 3 cut(s) 392, 488, 536
Ksp22I TGATCA 1 cut(s) 313
Kzo9I GATC 3 cut(s) 36, 313, 418
LmnI GCTCC 2 cut(s) 19, 487
LpnPI CCDG 6 cut(s) 150, 161, 256, 365, 465, 469
Lsp1109I GCAGC 9 cut(s) 106, 127, 172, 210, 237, 264, 358, 481, 503
MaeI CTAG 3 cut(s) 47, 335, 486
MaeIII GTNAC 1 cut(s) 284
MalI GATC 3 cut(s) 38, 315, 420
MbiI CCGCTC 1 cut(s) 482
MboI GATC 3 cut(s) 36, 313, 418
MboII GAAGA 4 cut(s) 183, 210, 237, 533
MhlI GDGCHC 1 cut(s) 363
MluCI AATT 2 cut(s) 425, 540
MnlI CCTC 3 cut(s) 27, 312, 376
MroXI GAANNNNTTC 3 cut(s) 71, 214, 241
MseI TTAA 2 cut(s) 107, 474
MspA1I CMGCKG 2 cut(s) 185, 494
MspCI CTTAAG 1 cut(s) 106
MspI CCGG 1 cut(s) 452
MwoI GCNNNNNNNGC 3 cut(s) 392, 488, 536
NdeII GATC 3 cut(s) 36, 313, 418
NlaIV GGNNCC 2 cut(s) 135, 294
NmuCI GTSAC 1 cut(s) 284
PcsI WCGNNNNNNNCGW 1 cut(s) 99
PdmI GAANNNNTTC 3 cut(s) 71, 214, 241
PfeI GAWTC 1 cut(s) 340
PshAI GACNNNNGTC 1 cut(s) 108
PspFI CCCAGC 1 cut(s) 147
PspN4I GGNNCC 2 cut(s) 135, 294
PspPI GGNCC 3 cut(s) 273, 385, 394
PstI CTGCAG 1 cut(s) 348
PvuII CAGCTG 2 cut(s) 185, 494
RsaI GTAC 1 cut(s) 406
RsaNI GTAC 1 cut(s) 405
SaqAI TTAA 2 cut(s) 107, 474
Sau3AI GATC 3 cut(s) 36, 313, 418
Sau96I GGNCC 3 cut(s) 273, 385, 394
SduI GDGCHC 1 cut(s) 363
SetI ASST 9 cut(s) 31, 48, 159, 169, 187, 282, 351, 496, 532
SfcI CTRYAG 1 cut(s) 344
SfiI GGCCNNNNNGGCC 1 cut(s) 392
SmlI CTYRAG 2 cut(s) 106, 354
SmoI CTYRAG 2 cut(s) 106, 354
Sse9I AATT 2 cut(s) 425, 540
SsiI CCGC 4 cut(s) 144, 369, 480, 582
SspMI CTAG 3 cut(s) 47, 335, 486
StyI CCWWGG 2 cut(s) 153, 276
TaaI ACNGT 2 cut(s) 414, 472
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 425, 540
TatI WGTACW 1 cut(s) 404
TauI GCSGC 2 cut(s) 146, 482
TfiI GAWTC 1 cut(s) 340
Tru1I TTAA 2 cut(s) 107, 474
Tru9I TTAA 2 cut(s) 107, 474
TscAI CASTG 1 cut(s) 475
TseFI GTSAC 1 cut(s) 284
TseI GCWGC 9 cut(s) 119, 140, 185, 198, 225, 252, 346, 491, 494
Tsp45I GTSAC 1 cut(s) 284
TspDTI ATGAA 1 cut(s) 543
TspRI CASTG 1 cut(s) 475
Vha464I CTTAAG 1 cut(s) 106
XmnI GAANNNNTTC 3 cut(s) 71, 214, 241
XspI CTAG 3 cut(s) 47, 335, 486
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.