Rh3CG267900

Plasminogen activator inhibitor 1 RNA-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0018554
Physical Location & Seq
Reverse (-)
26355812 .. 26360077
4266 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG267900.1

Sequence Viewer

Length: 300 bp
ATGGGTTTTGGGATCGACAACCTAGAAGGAGAAGGAACTACAAACGCTTTCGATCTGTTAGGCGATGACGACAATGACGACTTAAGTCAACTTGCTGCTATGGTGGTGGTTCCTGCTACTGCCCAGCCCAAGCTCCCCTCCAAGCCTCTTCCTCCTGCTCAAAGGGACTGTAAACTAATGTGGAAGGAGCAAGAGTATGCAAAGTCGTTGATATTTTGCAATGTGATAATCATCTGCTCACATTCTATGAGATCTCCAATACCAGAATATAAAGGGTCAAATTTCTGGGCAGCGCCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HABP4_PAI-RBP1 Stm1_N

Protein Analysis

99

Amino Acids

10.87

Weight (kDa)

4.58

Isoelectric Point (pI)

36.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Stm1_N PF09598 13 - 55 3.6e-07 Stm1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018554)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0327461
rosa_multiflora Rmu_co8142420.1_g000001 Rmu_sc0005767.1_g000003
rosa_roxburghii Rroxscaffold_3G00240360
rosa_rugosa Rorug07G0349900
rosa_samantha Rh3CG267900 Rh4AG009400 Rh4CG209600 Rh5AG322800 Rh5DG558800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 20
AcsI RAATTY 1 cut(s) 280
AflII CTTAAG 1 cut(s) 82
AluBI AGCT 1 cut(s) 133
AluI AGCT 1 cut(s) 133
AlwI GGATC 1 cut(s) 20
ApeKI GCWGC 2 cut(s) 95, 290
ApoI RAATTY 1 cut(s) 280
AspLEI GCGC 1 cut(s) 295
BbvI GCAGC 1 cut(s) 82
BceAI ACGGC 1 cut(s) 280
BfaI CTAG 1 cut(s) 23
BfoI RGCGCY 1 cut(s) 296
BfrI CTTAAG 1 cut(s) 82
BglII AGATCT 1 cut(s) 251
BisI GCNGC 2 cut(s) 96, 291
BlsI GCNGC 2 cut(s) 97, 292
BmiI GGNNCC 1 cut(s) 111
BoxI GACNNNNGTC 1 cut(s) 84
BsaBI GATNNNNATC 1 cut(s) 230
BsaXI ACNNNNNCTCC 2 cut(s) 179, 209
Bse3DI GCAATG 1 cut(s) 226
Bse8I GATNNNNATC 1 cut(s) 230
BseJI GATNNNNATC 1 cut(s) 230
BseMI GCAATG 1 cut(s) 226
BseXI GCAGC 1 cut(s) 82
BseYI CCCAGC 1 cut(s) 123
BslFI GGGAC 1 cut(s) 179
BsmFI GGGAC 1 cut(s) 179
Bsp143I GATC 3 cut(s) 12, 52, 251
BspLI GGNNCC 1 cut(s) 111
BspPI GGATC 1 cut(s) 20
BspTI CTTAAG 1 cut(s) 82
BsrDI GCAATG 1 cut(s) 226
BssMI GATC 3 cut(s) 12, 52, 251
Bst4CI ACNGT 1 cut(s) 170
Bst6I CTCTTC 1 cut(s) 153
BstAFI CTTAAG 1 cut(s) 82
BstH2I RGCGCY 1 cut(s) 296
BstHHI GCGC 1 cut(s) 295
BstKTI GATC 3 cut(s) 15, 55, 254
BstMBI GATC 3 cut(s) 12, 52, 251
BstPAI GACNNNNGTC 1 cut(s) 84
BstV1I GCAGC 1 cut(s) 82
BstX2I RGATCY 1 cut(s) 251
BstYI RGATCY 1 cut(s) 251
BtgZI GCGATG 1 cut(s) 78
CfoI GCGC 1 cut(s) 295
CviJI RGCY 3 cut(s) 127, 133, 145
CviKI_1 RGCY 3 cut(s) 127, 133, 145
DpnI GATC 3 cut(s) 14, 54, 253
DpnII GATC 3 cut(s) 12, 52, 251
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
FaiI YATR 4 cut(s) 101, 198, 248, 270
FaqI GGGAC 1 cut(s) 179
Fnu4HI GCNGC 2 cut(s) 96, 291
Fsp4HI GCNGC 2 cut(s) 96, 291
FspBI CTAG 1 cut(s) 23
GlaI GCGC 1 cut(s) 294
GluI GCNGC 2 cut(s) 96, 291
GsaI CCCAGC 1 cut(s) 127
HaeII RGCGCY 1 cut(s) 296
HhaI GCGC 1 cut(s) 295
Hin6I GCGC 1 cut(s) 293
HinP1I GCGC 1 cut(s) 293
HincII GTYRAC 1 cut(s) 89
HindII GTYRAC 1 cut(s) 89
Hpy166II GTNNAC 2 cut(s) 89, 173
Hpy8I GTNNAC 2 cut(s) 89, 173
HpyAV CCTTC 3 cut(s) 20, 26, 178
HpyCH4III ACNGT 1 cut(s) 170
HpyCH4V TGCA 2 cut(s) 200, 219
HspAI GCGC 1 cut(s) 293
Kzo9I GATC 3 cut(s) 12, 52, 251
LmnI GCTCC 2 cut(s) 138, 187
LpnPI CCDG 5 cut(s) 126, 137, 168, 271, 276
Lsp1109I GCAGC 1 cut(s) 82
MaeI CTAG 1 cut(s) 23
MalI GATC 3 cut(s) 14, 54, 253
MboI GATC 3 cut(s) 12, 52, 251
MboII GAAGA 1 cut(s) 140
MflI RGATCY 1 cut(s) 251
MluCI AATT 1 cut(s) 280
MnlI CCTC 3 cut(s) 148, 156, 162
MseI TTAA 1 cut(s) 83
MspCI CTTAAG 1 cut(s) 82
NdeII GATC 3 cut(s) 12, 52, 251
NlaIV GGNNCC 1 cut(s) 111
PcsI WCGNNNNNNNCGW 1 cut(s) 75
PkrI GCNGC 2 cut(s) 97, 292
PshAI GACNNNNGTC 1 cut(s) 84
PspFI CCCAGC 1 cut(s) 123
PspN4I GGNNCC 1 cut(s) 111
PsuI RGATCY 1 cut(s) 251
SaqAI TTAA 1 cut(s) 83
SatI GCNGC 2 cut(s) 96, 291
Sau3AI GATC 3 cut(s) 12, 52, 251
SetI ASST 2 cut(s) 24, 135
SgeI CNNG 9 cut(s) 35, 104, 125, 136, 142, 154, 167, 203, 275
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 1 cut(s) 280
SspMI CTAG 1 cut(s) 23
TaaI ACNGT 1 cut(s) 170
TaqI TCGA 2 cut(s) 15, 51
TasI AATT 1 cut(s) 280
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TseI GCWGC 2 cut(s) 95, 290
Vha464I CTTAAG 1 cut(s) 82
XapI RAATTY 1 cut(s) 280
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.