RchiOBHm_Chr1g0335081

U5 small nuclear ribonucleoprotein 200 kDa

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
27266768 .. 27267013
246 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGCATGGCTTAGAAGGTGATGTTCTGACAGAAGATAGTAAGCTGGAGGAGAGGCGAGCTGATTTGATCCATTCCACTGCAACCATCTTGGAGAAGAACAACATGATCAAATATGATAGAAAAAGTGGATACTTTCATGTTACAGACTTGGGTCGCATTGCCAGTCATTATTATATAACACATGGAACAGTGTGCACATATAATGAGCATTTAAAGCCAACGATGGGGGACAGTGAGCTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.27

Weight (kDa)

5.79

Isoelectric Point (pI)

45.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sec63 PF02889 48 - 80 6.5e-09 Sec63 Brl domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AfiI CCNNNNNNNGG 1 cut(s) 224
AluBI AGCT 3 cut(s) 43, 59, 238
AluI AGCT 3 cut(s) 43, 59, 238
Alw21I GWGCWC 1 cut(s) 197
Alw44I GTGCAC 1 cut(s) 193
AlwI GGATC 1 cut(s) 61
ApaLI GTGCAC 1 cut(s) 193
AsuHPI GGTGA 1 cut(s) 29
BaeGI GKGCMC 1 cut(s) 197
Bbv12I GWGCWC 1 cut(s) 197
BccI CCATC 2 cut(s) 92, 217
BciVI GTATCC 1 cut(s) 122
BclI TGATCA 1 cut(s) 105
BfuI GTATCC 1 cut(s) 122
BoxI GACNNNNGTC 1 cut(s) 150
BpmI CTGGAG 1 cut(s) 65
Bsc4I CCNNNNNNNGG 1 cut(s) 224
Bse1I ACTGG 1 cut(s) 162
Bse3DI GCAATG 1 cut(s) 156
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMI GCAATG 1 cut(s) 156
BseNI ACTGG 1 cut(s) 162
BseRI GAGGAG 1 cut(s) 62
BseSI GKGCMC 1 cut(s) 197
BsiHKAI GWGCWC 1 cut(s) 197
BslFI GGGAC 1 cut(s) 242
BslI CCNNNNNNNGG 1 cut(s) 224
BsmFI GGGAC 1 cut(s) 242
Bsp1286I GDGCHC 1 cut(s) 197
Bsp143I GATC 2 cut(s) 66, 105
BspPI GGATC 1 cut(s) 61
BsrDI GCAATG 1 cut(s) 156
BsrI ACTGG 1 cut(s) 162
BssMI GATC 2 cut(s) 66, 105
Bst4CI ACNGT 2 cut(s) 190, 233
BstC8I GCNNGC 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 10
BstKTI GATC 2 cut(s) 69, 108
BstMBI GATC 2 cut(s) 66, 105
BstMWI GCNNNNNNNGC 1 cut(s) 214
BstPAI GACNNNNGTC 1 cut(s) 150
BstSLI GKGCMC 1 cut(s) 197
BsuI GTATCC 1 cut(s) 122
BtsI GCAGTG 1 cut(s) 75
BtsIMutI CAGTG 3 cut(s) 75, 195, 238
Cac8I GCNNGC 1 cut(s) 57
CviAII CATG 4 cut(s) 5, 103, 137, 182
CviJI RGCY 5 cut(s) 9, 43, 59, 217, 238
CviKI_1 RGCY 5 cut(s) 9, 43, 59, 217, 238
DdeI CTNAG 1 cut(s) 10
DpnI GATC 2 cut(s) 68, 107
DpnII GATC 2 cut(s) 66, 105
DraI TTTAAA 1 cut(s) 213
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 4 cut(s) 8, 106, 140, 185
FaiI YATR 9 cut(s) 6, 104, 114, 138, 174, 176, 183, 199, 201
FaqI GGGAC 1 cut(s) 242
FatI CATG 4 cut(s) 4, 102, 136, 181
FbaI TGATCA 1 cut(s) 105
GsuI CTGGAG 1 cut(s) 65
Hin1II CATG 4 cut(s) 8, 106, 140, 185
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 195
Hpy188I TCNGA 1 cut(s) 27
Hpy8I GTNNAC 1 cut(s) 195
HpyAV CCTTC 1 cut(s) 8
HpyCH4III ACNGT 2 cut(s) 190, 233
HpyCH4V TGCA 3 cut(s) 4, 80, 195
HpyF10VI GCNNNNNNNGC 1 cut(s) 214
HpyF3I CTNAG 1 cut(s) 10
Hsp92II CATG 4 cut(s) 8, 106, 140, 185
Ksp22I TGATCA 1 cut(s) 105
Kzo9I GATC 2 cut(s) 66, 105
LpnPI CCDG 2 cut(s) 29, 175
MaeIII GTNAC 1 cut(s) 139
MalI GATC 2 cut(s) 68, 107
MboI GATC 2 cut(s) 66, 105
MboII GAAGA 2 cut(s) 44, 106
MhlI GDGCHC 1 cut(s) 197
MnlI CCTC 2 cut(s) 40, 45
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 212
MwoI GCNNNNNNNGC 1 cut(s) 214
NdeII GATC 2 cut(s) 66, 105
NlaIII CATG 4 cut(s) 8, 106, 140, 185
NsiI ATGCAT 1 cut(s) 6
PshAI GACNNNNGTC 1 cut(s) 150
SaqAI TTAA 1 cut(s) 212
Sau3AI GATC 2 cut(s) 66, 105
SduI GDGCHC 1 cut(s) 197
SetI ASST 4 cut(s) 19, 45, 61, 240
SgeI CNNG 9 cut(s) 17, 56, 68, 100, 115, 149, 160, 174, 194
TaaI ACNGT 2 cut(s) 190, 233
Tru1I TTAA 1 cut(s) 212
Tru9I TTAA 1 cut(s) 212
TscAI CASTG 3 cut(s) 82, 195, 238
TspDTI ATGAA 1 cut(s) 125
TspRI CASTG 3 cut(s) 82, 195, 238
VneI GTGCAC 1 cut(s) 193
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.