RchiOBHm_Chr1g0340811

Nucleolar protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0018482
Physical Location & Seq
Forward (+)
32392489 .. 32392735
247 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGGCTGGGCTAACCATTGGATGGTATGTTGTTCCCTGCAGCTTTGTCCAGGGTATAGACTACGATACAGACCGTGAACGGGTTGAGAGAAAGAAGTTGAAGAAGCGTTTGACACAGGAAGGTAAAGGTGCTGTTCGCGAAGTGCGTAAAGATAATTATTTCTTACAGGAGCTGAAGTCGAGGGATAAGGCTCTGATGGAAGAAGAGAGAGCTAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Nop14

Protein Analysis

72

Amino Acids

8.47

Weight (kDa)

9.16

Isoelectric Point (pI)

30.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Nop14 PF04147 17 - 71 5.5e-14 Nop14-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018482)

Species Orthologous Gene IDs
malus_domestica MD13G1058800.v1.1
pyrus_communis pycom13g05240
rosa_chinensis RchiOBHm_Chr1g0340811
rosa_laevigata RLG00000029046
rosa_multiflora Rmu_co8097760.1_g000001 Rmu_sc0002200.1_g000056
rosa_roxburghii Rroxscaffold_4G00311500
rosa_samantha Rh1BG144200 Rh1CG164000 Rh1DG175900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 21
AccII CGCG 1 cut(s) 138
AcuI CTGAAG 1 cut(s) 194
AfiI CCNNNNNNNGG 2 cut(s) 21, 79
AgsI TTSAA 1 cut(s) 100
AjnI CCWGG 1 cut(s) 48
AluBI AGCT 4 cut(s) 42, 172, 212, 216
AluI AGCT 4 cut(s) 42, 172, 212, 216
AlwNI CAGNNNCTG 1 cut(s) 172
ApeKI GCWGC 1 cut(s) 39
AsuNHI GCTAGC 1 cut(s) 212
BbvI GCAGC 1 cut(s) 51
BccI CCATC 2 cut(s) 15, 190
BciT130I CCWGG 1 cut(s) 50
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 37
BisI GCNGC 1 cut(s) 40
BlsI GCNGC 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 50
BmrFI CCNGG 1 cut(s) 50
BmtI GCTAGC 1 cut(s) 216
BsaJI CCNNGG 1 cut(s) 49
BsaXI ACNNNNNCTCC 2 cut(s) 161, 191
Bsc4I CCNNNNNNNGG 2 cut(s) 21, 79
BseBI CCWGG 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 49
BseGI GGATG 1 cut(s) 26
BseLI CCNNNNNNNGG 2 cut(s) 21, 79
BseXI GCAGC 1 cut(s) 51
BseYI CCCAGC 1 cut(s) 5
Bsh1236I CGCG 1 cut(s) 138
BslI CCNNNNNNNGG 2 cut(s) 21, 79
Bsp68I TCGCGA 1 cut(s) 138
BspFNI CGCG 1 cut(s) 138
BspMAI CTGCAG 1 cut(s) 41
BspOI GCTAGC 1 cut(s) 216
BssECI CCNNGG 1 cut(s) 49
Bst2UI CCWGG 1 cut(s) 50
Bst4CI ACNGT 1 cut(s) 74
Bst6I CTCTTC 1 cut(s) 198
BstC8I GCNNGC 1 cut(s) 214
BstF5I GGATG 1 cut(s) 26
BstFNI CGCG 1 cut(s) 138
BstNI CCWGG 1 cut(s) 50
BstSCI CCNGG 1 cut(s) 48
BstSFI CTRYAG 1 cut(s) 37
BstUI CGCG 1 cut(s) 138
BstV1I GCAGC 1 cut(s) 51
BtsCI GGATG 1 cut(s) 26
BtuMI TCGCGA 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 214
CaiI CAGNNNCTG 1 cut(s) 172
CviJI RGCY 7 cut(s) 5, 10, 42, 172, 191, 212, 216
CviKI_1 RGCY 7 cut(s) 5, 10, 42, 172, 191, 212, 216
Eam1104I CTCTTC 1 cut(s) 198
EarI CTCTTC 1 cut(s) 198
Eco57I CTGAAG 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 48
FaiI YATR 2 cut(s) 27, 56
Fnu4HI GCNGC 1 cut(s) 40
FokI GGATG 1 cut(s) 33
Fsp4HI GCNGC 1 cut(s) 40
FspBI CTAG 1 cut(s) 213
GluI GCNGC 1 cut(s) 40
GsaI CCCAGC 1 cut(s) 9
Hpy166II GTNNAC 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 195
Hpy188III TCNNGA 1 cut(s) 137
Hpy8I GTNNAC 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 74
HpyCH4V TGCA 1 cut(s) 39
LmnI GCTCC 1 cut(s) 169
LpnPI CCDG 5 cut(s) 35, 49, 62, 101, 152
Lsp1109I GCAGC 1 cut(s) 51
MaeI CTAG 1 cut(s) 213
MboII GAAGA 3 cut(s) 112, 212, 215
MluCI AATT 1 cut(s) 154
MnlI CCTC 1 cut(s) 174
MspR9I CCNGG 1 cut(s) 50
MvaI CCWGG 1 cut(s) 50
MvnI CGCG 1 cut(s) 138
NheI GCTAGC 1 cut(s) 212
NruI TCGCGA 1 cut(s) 138
PcsI WCGNNNNNNNCGW 1 cut(s) 142
PflMI CCANNNNNTGG 1 cut(s) 21
PkrI GCNGC 1 cut(s) 41
Psp6I CCWGG 1 cut(s) 48
PspFI CCCAGC 1 cut(s) 5
PspGI CCWGG 1 cut(s) 48
PstI CTGCAG 1 cut(s) 41
PstNI CAGNNNCTG 1 cut(s) 172
RruI TCGCGA 1 cut(s) 138
SatI GCNGC 1 cut(s) 40
ScrFI CCNGG 1 cut(s) 50
SetI ASST 6 cut(s) 44, 124, 130, 174, 214, 218
SfcI CTRYAG 1 cut(s) 37
Sse9I AATT 1 cut(s) 154
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 48
TaaI ACNGT 1 cut(s) 74
TaqI TCGA 1 cut(s) 179
TasI AATT 1 cut(s) 154
TseI GCWGC 1 cut(s) 39
Van91I CCANNNNNTGG 1 cut(s) 21
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.