Rroxscaffold_4G00311500

Nucleolar protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
34020863 .. 34021660
798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00311500.1

Sequence Viewer

Length: 255 bp
ATGGAAGAAGAAAGAGCTGAGAAATATGGAAAAGCAAGACTTTTCCTTCAGGAGCAAGAACATGATATGAAATCTGGGCATGCAATTAGGAAAATGCAGGGGGAAGAGAAGATGATGAGCTCAACTTATGTTATGTTGGTTGCCATTACGTTGCAGTTCTCATTCGAGGTTCATACAAACGCAATACTAGTATTCTCATCTCTCTGCTTGTGTTTTGTAACTTTTGTTCATAGTAATGTTTTGAGCTTGGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.68

Weight (kDa)

6.04

Isoelectric Point (pI)

50.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018482)

Species Orthologous Gene IDs
malus_domestica MD13G1058800.v1.1
pyrus_communis pycom13g05240
rosa_chinensis RchiOBHm_Chr1g0340811
rosa_laevigata RLG00000029046
rosa_multiflora Rmu_co8097760.1_g000001 Rmu_sc0002200.1_g000056
rosa_roxburghii Rroxscaffold_4G00311500
rosa_samantha Rh1BG144200 Rh1CG164000 Rh1DG175900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 32
AhlI ACTAGT 1 cut(s) 187
AluBI AGCT 3 cut(s) 17, 120, 246
AluI AGCT 3 cut(s) 17, 120, 246
Alw21I GWGCWC 1 cut(s) 122
BanII GRGCYC 1 cut(s) 122
Bbv12I GWGCWC 1 cut(s) 122
BcuI ACTAGT 1 cut(s) 187
BfaI CTAG 1 cut(s) 188
BseMII CTCAG 1 cut(s) 9
BsiHKAI GWGCWC 1 cut(s) 122
Bsp1286I GDGCHC 1 cut(s) 122
BspCNI CTCAG 1 cut(s) 10
Bst6I CTCTTC 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 18
BstNSI RCATGY 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 81
CviAII CATG 2 cut(s) 62, 80
CviJI RGCY 3 cut(s) 17, 120, 246
CviKI_1 RGCY 3 cut(s) 17, 120, 246
DdeI CTNAG 1 cut(s) 18
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Ecl136II GAGCTC 1 cut(s) 120
Eco24I GRGCYC 1 cut(s) 122
Eco53kI GAGCTC 1 cut(s) 120
Eco57I CTGAAG 1 cut(s) 32
EcoICRI GAGCTC 1 cut(s) 120
EcoT38I GRGCYC 1 cut(s) 122
FaeI CATG 2 cut(s) 65, 83
FaiI YATR 8 cut(s) 27, 63, 68, 81, 129, 134, 174, 231
FalI AAGNNNNNCTT 2 cut(s) 24, 56
FatI CATG 2 cut(s) 61, 79
FriOI GRGCYC 1 cut(s) 122
FspBI CTAG 1 cut(s) 188
Hin1II CATG 2 cut(s) 65, 83
Hpy188I TCNGA 1 cut(s) 254
Hpy188III TCNNGA 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 56
HpyCH4IV ACGT 1 cut(s) 149
HpyCH4V TGCA 3 cut(s) 83, 97, 154
HpyF3I CTNAG 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 149
Hsp92II CATG 2 cut(s) 65, 83
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 3 cut(s) 35, 60, 83
MaeI CTAG 1 cut(s) 188
MaeII ACGT 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 217
MboII GAAGA 4 cut(s) 17, 20, 116, 121
MhlI GDGCHC 1 cut(s) 122
MluCI AATT 1 cut(s) 84
MnlI CCTC 1 cut(s) 160
MslI CAYNNNNRTG 1 cut(s) 234
NlaIII CATG 2 cut(s) 65, 83
NspI RCATGY 1 cut(s) 83
PaeI GCATGC 1 cut(s) 83
Psp124BI GAGCTC 1 cut(s) 122
PsrI GAACNNNNNNTAC 2 cut(s) 210, 242
RseI CAYNNNNRTG 1 cut(s) 234
SacI GAGCTC 1 cut(s) 122
SduI GDGCHC 1 cut(s) 122
SetI ASST 5 cut(s) 19, 122, 152, 171, 248
SmiMI CAYNNNNRTG 1 cut(s) 234
SpeI ACTAGT 1 cut(s) 187
SphI GCATGC 1 cut(s) 83
Sse9I AATT 1 cut(s) 84
SspMI CTAG 1 cut(s) 188
SstI GAGCTC 1 cut(s) 122
TaiI ACGT 1 cut(s) 152
TaqI TCGA 1 cut(s) 165
TasI AATT 1 cut(s) 84
TspDTI ATGAA 3 cut(s) 83, 161, 218
XceI RCATGY 1 cut(s) 83
XspI CTAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.