RchiOBHm_Chr1g0359161

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
51214784 .. 51215509
726 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58422

Sequence Viewer

Length: 726 bp
ATGGAGATTTTCATGAAGACCCCGTCCGGCAAGACCATAACTCTAGAGGTAGAGAAGATTGATGCGATAGGGGATGTAAAGGCAACGGTTCAAGACCAGAAACTGCTCATGTTGTTTGATAAACAGCTTGACGATGACATGACTTTGGCAGACTGTAATATCTGGGAGAACTGTACTTTACGTCTGGTCTTCCGAATGCAGATCTTTGTCGAAATCCAAAATGGGAGGACAATCGCTCTTGAGGTCGAGAGTTCTGATACAATTCACAACGTGAAGGAAAAAATCCAAGAAACTGAGGGCATTCCACCAATAAACCAGAGGCTTATTTTTGCTGGGAAGCAACTTGAGGATGGGAGGCGAACTCTGGCTGATTGTAGCATCCAGATTGAGTCTACCCTTGAGCTTCGTGTTCGAGGATCGATACATGTTTTCGTTAAACAACTCGGTGGGAAGAAATCATGTTTTGAGGTTAGGAGTTGTGATACAATTTGGAGTTTCAAGAATAGAATCTATGCCAAAGAGGGTATCCCAGAATATGAACAGAAGCTTATCTTTCATAATAAGCAATTGGAGGATGGAAGTACTCTTGCTGATAATAACATCCAGAATGGAACTACTGTGTTCCTTGTGCATGAATTTGGTGGACCTACTGGTCAAAGTCATTGGCGATGGTTATTGGGATCACGTAGACTTTCATGCTTTTTAGTATTTAGTATTGAGTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

241

Amino Acids

27.62

Weight (kDa)

5.63

Isoelectric Point (pI)

48.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 3 - 66 4e-08 Ubiquitin family
Rad60-SLD PF11976 66 - 137 6.2e-10 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 68 - 138 2.1e-21 Ubiquitin family
Rad60-SLD PF11976 141 - 207 2.6e-08 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 143 - 210 9.1e-17 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021109)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g16171
rosa_chinensis RchiOBHm_Chr1g0359161
rosa_samantha Rh1AG281800 Rh1CG266200 Rh1DG277300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 651
AccI GTMKAC 2 cut(s) 392, 688
AclWI GGATC 2 cut(s) 424, 688
AcsI RAATTY 1 cut(s) 635
AdeI CACNNNGTG 1 cut(s) 271
AfaI GTAC 2 cut(s) 175, 583
AflIII ACRYGT 1 cut(s) 424
AgsI TTSAA 2 cut(s) 92, 499
AluBI AGCT 3 cut(s) 127, 403, 547
AluI AGCT 3 cut(s) 127, 403, 547
AlwI GGATC 2 cut(s) 424, 688
AlwNI CAGNNNCTG 1 cut(s) 103
ApoI RAATTY 1 cut(s) 635
AspS9I GGNCC 1 cut(s) 644
AvaII GGWCC 1 cut(s) 644
BbsI GAAGAC 2 cut(s) 23, 181
BccI CCATC 3 cut(s) 344, 569, 663
BciVI GTATCC 1 cut(s) 536
BfaI CTAG 1 cut(s) 44
BfuI GTATCC 1 cut(s) 536
BglII AGATCT 1 cut(s) 201
BmcAI AGTACT 1 cut(s) 583
Bme18I GGWCC 1 cut(s) 644
BmgT120I GGNCC 1 cut(s) 644
BmsI GCATC 2 cut(s) 52, 387
BpiI GAAGAC 2 cut(s) 23, 181
BplI GAGNNNNNCTC 2 cut(s) 346, 378
BpuEI CTTGAG 3 cut(s) 260, 365, 419
Bsa29I ATCGAT 1 cut(s) 419
BsaAI YACGTR 1 cut(s) 686
Bse1I ACTGG 1 cut(s) 655
BseCI ATCGAT 1 cut(s) 419
BseGI GGATG 5 cut(s) 79, 355, 378, 580, 600
BseMII CTCAG 1 cut(s) 285
BseNI ACTGG 1 cut(s) 655
BseYI CCCAGC 1 cut(s) 332
BshVI ATCGAT 1 cut(s) 419
BsiSI CCGG 1 cut(s) 27
BsmI GAATGC 2 cut(s) 201, 300
Bsp143I GATC 3 cut(s) 201, 416, 680
BspCNI CTCAG 1 cut(s) 286
BspDI ATCGAT 1 cut(s) 419
BspHI TCATGA 1 cut(s) 12
BspPI GGATC 2 cut(s) 424, 688
BsrI ACTGG 1 cut(s) 655
BssMI GATC 3 cut(s) 201, 416, 680
Bst4CI ACNGT 4 cut(s) 88, 155, 173, 619
BstBAI YACGTR 1 cut(s) 686
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 5 cut(s) 79, 355, 378, 580, 600
BstKTI GATC 3 cut(s) 204, 419, 683
BstMBI GATC 3 cut(s) 201, 416, 680
BstNSI RCATGY 1 cut(s) 428
BstV2I GAAGAC 2 cut(s) 23, 181
BstX2I RGATCY 1 cut(s) 201
BstYI RGATCY 1 cut(s) 201
Bsu15I ATCGAT 1 cut(s) 419
BsuI GTATCC 1 cut(s) 536
BsuTUI ATCGAT 1 cut(s) 419
BtgZI GCGATG 1 cut(s) 682
BtsCI GGATG 5 cut(s) 79, 355, 378, 580, 600
CaiI CAGNNNCTG 1 cut(s) 103
CciI TCATGA 1 cut(s) 12
Cfr13I GGNCC 1 cut(s) 644
ClaI ATCGAT 1 cut(s) 419
Csp6I GTAC 2 cut(s) 174, 582
CviAII CATG 7 cut(s) 13, 109, 139, 425, 459, 632, 696
CviJI RGCY 5 cut(s) 127, 322, 368, 403, 547
CviKI_1 RGCY 5 cut(s) 127, 322, 368, 403, 547
CviQI GTAC 2 cut(s) 174, 582
DdeI CTNAG 1 cut(s) 294
DpnI GATC 3 cut(s) 203, 418, 682
DpnII GATC 3 cut(s) 201, 416, 680
DraIII CACNNNGTG 1 cut(s) 271
DrdI GACNNNNNNGTC 1 cut(s) 651
DseDI GACNNNNNNGTC 1 cut(s) 651
Eco47I GGWCC 1 cut(s) 644
FaeI CATG 7 cut(s) 16, 112, 142, 428, 462, 635, 699
FalI AAGNNNNNCTT 2 cut(s) 536, 568
FatI CATG 7 cut(s) 12, 108, 138, 424, 458, 631, 695
FblI GTMKAC 2 cut(s) 392, 688
FokI GGATG 5 cut(s) 86, 362, 365, 587, 587
FspBI CTAG 1 cut(s) 44
GsaI CCCAGC 1 cut(s) 336
HapII CCGG 1 cut(s) 27
Hin1II CATG 7 cut(s) 16, 112, 142, 428, 462, 635, 699
HindIII AAGCTT 1 cut(s) 545
HinfI GANTC 2 cut(s) 389, 507
HpaII CCGG 1 cut(s) 27
Hpy166II GTNNAC 3 cut(s) 393, 644, 689
Hpy188I TCNGA 2 cut(s) 194, 256
Hpy188III TCNNGA 8 cut(s) 13, 44, 92, 239, 247, 382, 499, 604
Hpy8I GTNNAC 3 cut(s) 393, 644, 689
HpyAV CCTTC 1 cut(s) 268
HpyCH4III ACNGT 4 cut(s) 88, 155, 173, 619
HpyCH4IV ACGT 3 cut(s) 181, 270, 685
HpyCH4V TGCA 2 cut(s) 199, 631
HpyF3I CTNAG 1 cut(s) 294
HpySE526I ACGT 3 cut(s) 181, 270, 685
Hsp92II CATG 7 cut(s) 16, 112, 142, 428, 462, 635, 699
Kzo9I GATC 3 cut(s) 201, 416, 680
LweI GCATC 2 cut(s) 52, 387
MaeI CTAG 1 cut(s) 44
MaeII ACGT 3 cut(s) 181, 270, 685
MalI GATC 3 cut(s) 203, 418, 682
MboI GATC 3 cut(s) 201, 416, 680
MboII GAAGA 4 cut(s) 28, 67, 181, 463
MfeI CAATTG 1 cut(s) 566
MflI RGATCY 1 cut(s) 201
MluCI AATT 4 cut(s) 261, 486, 566, 635
MlyI GAGTC 1 cut(s) 398
MseI TTAA 1 cut(s) 435
MspI CCGG 1 cut(s) 27
MunI CAATTG 1 cut(s) 566
Mva1269I GAATGC 2 cut(s) 201, 300
NdeII GATC 3 cut(s) 201, 416, 680
NlaIII CATG 7 cut(s) 16, 112, 142, 428, 462, 635, 699
NspI RCATGY 1 cut(s) 428
PagI TCATGA 1 cut(s) 12
PciI ACATGT 1 cut(s) 424
PctI GAATGC 2 cut(s) 201, 300
PfeI GAWTC 1 cut(s) 507
PflFI GACNNNGTC 1 cut(s) 22
PleI GAGTC 1 cut(s) 397
PpsI GAGTC 1 cut(s) 397
Ppu21I YACGTR 1 cut(s) 686
PscI ACATGT 1 cut(s) 424
PspFI CCCAGC 1 cut(s) 332
PspPI GGNCC 1 cut(s) 644
PstNI CAGNNNCTG 1 cut(s) 103
PsuI RGATCY 1 cut(s) 201
PsyI GACNNNGTC 1 cut(s) 22
RsaI GTAC 2 cut(s) 175, 583
RsaNI GTAC 2 cut(s) 174, 582
SaqAI TTAA 1 cut(s) 435
Sau3AI GATC 3 cut(s) 201, 416, 680
Sau96I GGNCC 1 cut(s) 644
ScaI AGTACT 1 cut(s) 583
SchI GAGTC 1 cut(s) 398
SfaNI GCATC 2 cut(s) 52, 387
SinI GGWCC 1 cut(s) 644
SmlI CTYRAG 3 cut(s) 239, 344, 398
SmoI CTYRAG 3 cut(s) 239, 344, 398
Sse9I AATT 4 cut(s) 261, 486, 566, 635
SspMI CTAG 1 cut(s) 44
TaaI ACNGT 4 cut(s) 88, 155, 173, 619
TaiI ACGT 3 cut(s) 184, 273, 688
TaqI TCGA 4 cut(s) 210, 246, 412, 419
TasI AATT 4 cut(s) 261, 486, 566, 635
TatI WGTACW 2 cut(s) 173, 581
TfiI GAWTC 1 cut(s) 507
Tru1I TTAA 1 cut(s) 435
Tru9I TTAA 1 cut(s) 435
TspDTI ATGAA 5 cut(s) 29, 545, 552, 648, 684
Tth111I GACNNNGTC 1 cut(s) 22
VpaK11BI GGWCC 1 cut(s) 644
XapI RAATTY 1 cut(s) 635
XbaI TCTAGA 1 cut(s) 43
XceI RCATGY 1 cut(s) 428
XmiI GTMKAC 2 cut(s) 392, 688
XspI CTAG 1 cut(s) 44
ZrmI AGTACT 1 cut(s) 583
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.