Rh1CG266200

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0021109
Physical Location & Seq
Reverse (-)
53156040 .. 53156336
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG266200.1

Sequence Viewer

Length: 297 bp
ATGACTTTGGCAGACTGTAATATCTGGGAGAACTATACTTTACGTCTGGTCTTCGGAATGCAGATCTTTGTAGAAATCCAAAATGGGAGGACAATCGCTCTTGAGGTCGAGAGTTCTGAGGGCATTCCACCAATAAACCAGAGGCTTATTTTTGCTGGGAAGCAACTTGAGGATGGGAGGAGAACTCTGGCTGATTGTAGCATCCAGAATGAGTCTACCCTTGAGCTTCGTGTTCGAGGATCGATACATGTTTTCGTTAAGGAACAGTATGGGAGACGTGACCAGTACTCTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

98

Amino Acids

11.23

Weight (kDa)

5.35

Isoelectric Point (pI)

37.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 36 - 79 4.1e-11 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021109)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g16171
rosa_chinensis RchiOBHm_Chr1g0359161
rosa_samantha Rh1AG281800 Rh1CG266200 Rh1DG277300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 215
AclWI GGATC 1 cut(s) 247
AfaI GTAC 1 cut(s) 287
AflIII ACRYGT 1 cut(s) 247
AjiI CACGTC 1 cut(s) 278
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
Alw26I GTCTC 1 cut(s) 268
AlwI GGATC 1 cut(s) 247
BbsI GAAGAC 1 cut(s) 43
BccI CCATC 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 268
BglII AGATCT 1 cut(s) 63
BmcAI AGTACT 1 cut(s) 287
BmgBI CACGTC 1 cut(s) 278
BmsI GCATC 1 cut(s) 210
BpiI GAAGAC 1 cut(s) 43
BplI GAGNNNNNCTC 2 cut(s) 169, 201
BpuEI CTTGAG 3 cut(s) 122, 188, 242
Bsa29I ATCGAT 1 cut(s) 242
Bse1I ACTGG 1 cut(s) 283
BseCI ATCGAT 1 cut(s) 242
BseGI GGATG 2 cut(s) 178, 201
BseMII CTCAG 1 cut(s) 108
BseNI ACTGG 1 cut(s) 283
BseRI GAGGAG 1 cut(s) 193
BseYI CCCAGC 1 cut(s) 155
BshVI ATCGAT 1 cut(s) 242
BsmAI GTCTC 1 cut(s) 268
BsmBI CGTCTC 1 cut(s) 268
BsmI GAATGC 2 cut(s) 63, 123
Bsp143I GATC 2 cut(s) 63, 239
BspCNI CTCAG 1 cut(s) 109
BspDI ATCGAT 1 cut(s) 242
BspPI GGATC 1 cut(s) 247
BsrI ACTGG 1 cut(s) 283
BssMI GATC 2 cut(s) 63, 239
Bst4CI ACNGT 2 cut(s) 17, 267
BstDEI CTNAG 1 cut(s) 117
BstF5I GGATG 2 cut(s) 178, 201
BstKTI GATC 2 cut(s) 66, 242
BstMAI GTCTC 1 cut(s) 268
BstMBI GATC 2 cut(s) 63, 239
BstNSI RCATGY 1 cut(s) 251
BstV2I GAAGAC 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 63
BstXI CCANNNNNNTGG 1 cut(s) 290
BstYI RGATCY 1 cut(s) 63
Bsu15I ATCGAT 1 cut(s) 242
BsuTUI ATCGAT 1 cut(s) 242
BtrI CACGTC 1 cut(s) 278
BtsCI GGATG 2 cut(s) 178, 201
ClaI ATCGAT 1 cut(s) 242
Csp6I GTAC 1 cut(s) 286
CviAII CATG 1 cut(s) 248
CviJI RGCY 4 cut(s) 145, 191, 226, 294
CviKI_1 RGCY 4 cut(s) 145, 191, 226, 294
CviQI GTAC 1 cut(s) 286
DdeI CTNAG 1 cut(s) 117
DpnI GATC 2 cut(s) 65, 241
DpnII GATC 2 cut(s) 63, 239
Esp3I CGTCTC 1 cut(s) 268
FaeI CATG 1 cut(s) 251
FaiI YATR 3 cut(s) 36, 249, 270
FatI CATG 1 cut(s) 247
FblI GTMKAC 1 cut(s) 215
FokI GGATG 2 cut(s) 185, 188
GsaI CCCAGC 1 cut(s) 159
Hin1II CATG 1 cut(s) 251
HinfI GANTC 1 cut(s) 212
Hpy166II GTNNAC 1 cut(s) 216
Hpy188I TCNGA 2 cut(s) 56, 118
Hpy188III TCNNGA 3 cut(s) 101, 109, 205
Hpy8I GTNNAC 1 cut(s) 216
HpyCH4III ACNGT 2 cut(s) 17, 267
HpyCH4IV ACGT 2 cut(s) 43, 277
HpyCH4V TGCA 1 cut(s) 61
HpyF3I CTNAG 1 cut(s) 117
HpySE526I ACGT 2 cut(s) 43, 277
Hsp92II CATG 1 cut(s) 251
Kzo9I GATC 2 cut(s) 63, 239
LpnPI CCDG 7 cut(s) 10, 32, 141, 152, 173, 218, 276
LweI GCATC 1 cut(s) 210
MaeII ACGT 2 cut(s) 43, 277
MaeIII GTNAC 1 cut(s) 278
MalI GATC 2 cut(s) 65, 241
MboI GATC 2 cut(s) 63, 239
MboII GAAGA 1 cut(s) 43
MflI RGATCY 1 cut(s) 63
MlyI GAGTC 1 cut(s) 221
MnlI CCTC 7 cut(s) 81, 97, 112, 135, 163, 171, 230
MseI TTAA 1 cut(s) 258
Mva1269I GAATGC 2 cut(s) 63, 123
NdeII GATC 2 cut(s) 63, 239
NlaIII CATG 1 cut(s) 251
NmuCI GTSAC 1 cut(s) 278
NspI RCATGY 1 cut(s) 251
PciI ACATGT 1 cut(s) 247
PctI GAATGC 2 cut(s) 63, 123
PleI GAGTC 1 cut(s) 220
PpsI GAGTC 1 cut(s) 220
PscI ACATGT 1 cut(s) 247
PspFI CCCAGC 1 cut(s) 155
PsuI RGATCY 1 cut(s) 63
RsaI GTAC 1 cut(s) 287
RsaNI GTAC 1 cut(s) 286
SaqAI TTAA 1 cut(s) 258
Sau3AI GATC 2 cut(s) 63, 239
ScaI AGTACT 1 cut(s) 287
SchI GAGTC 1 cut(s) 221
SetI ASST 4 cut(s) 46, 108, 228, 280
SfaNI GCATC 1 cut(s) 210
SmlI CTYRAG 3 cut(s) 101, 167, 221
SmoI CTYRAG 3 cut(s) 101, 167, 221
TaaI ACNGT 2 cut(s) 17, 267
TaiI ACGT 2 cut(s) 46, 280
TaqI TCGA 3 cut(s) 108, 235, 242
TatI WGTACW 1 cut(s) 285
Tru1I TTAA 1 cut(s) 258
Tru9I TTAA 1 cut(s) 258
TseFI GTSAC 1 cut(s) 278
Tsp45I GTSAC 1 cut(s) 278
XceI RCATGY 1 cut(s) 251
XmiI GTMKAC 1 cut(s) 215
ZrmI AGTACT 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.