Rh1DG277300

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0021109
Physical Location & Seq
Reverse (-)
49899169 .. 49900085
917 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG277300.1

Sequence Viewer

Length: 669 bp
ATGGAGATTTTCGTGAAGACCCCGTCCGGCAAGACCATAACTCTAGAGGTGGAGAAGATTGATACGATAGGGGATGTAAAGGGAAGGGTTCAAGACCAGAAACTGCTCATGTTGTTTGATAAACAGCTTGACGATGACATGACTTTGGCAGACTGTAATATCTGGGAGAACTGTACTTTACGTCTGGTCTTCGGAATGCAGATCTTTGTCGAAATCCAGAATGGGAGGACAATCGCTCTTGAGGTTGAGAGTTCTGATACAATTCACAACGTGAAGGAAAAAATCCAAGAAACTGAGGGCATTCTACCAATAAACCAGAGGCTCATTTTTGCTGGCAAGCAACTTGAGGATGGGAGGAGAACTCTGGCTGATTGTAGCATCCAGAATGAGTCTACCCTTGAGCTTCGTGTTCGAGGATCGATACATGTTTTCGTTAAACAACTCGGTGGGAAGAAATCATGTTTTGAGGTTAAGAGTTGTGATACAATTTGGAGTTTCAAGAATAAAATCTATGTCAAAGAGGGTATCCCAGAATATAAACAGAAGCTTATCTTTCATAATAAGCAATTAGAGGATGGAAGTACTCTTGCTGATAATAACATCCAGAATGGAACGACTGTGTTCCTTGTGCATGAATTTGGTGGACCTCCTGGTCAAAGTCATTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

222

Amino Acids

25.22

Weight (kDa)

5.61

Isoelectric Point (pI)

38.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 3 - 64 7.8e-10 Ubiquitin family
Rad60-SLD PF11976 66 - 137 1.5e-09 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 68 - 138 1.9e-21 Ubiquitin family
Rad60-SLD PF11976 141 - 207 6.1e-09 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 143 - 210 1.9e-17 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021109)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g16171
rosa_chinensis RchiOBHm_Chr1g0359161
rosa_samantha Rh1AG281800 Rh1CG266200 Rh1DG277300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 651
AccI GTMKAC 1 cut(s) 392
AclWI GGATC 1 cut(s) 424
AcsI RAATTY 1 cut(s) 635
AdeI CACNNNGTG 1 cut(s) 271
AfaI GTAC 2 cut(s) 175, 583
AflIII ACRYGT 1 cut(s) 424
AgsI TTSAA 2 cut(s) 92, 499
AjnI CCWGG 1 cut(s) 649
AluBI AGCT 3 cut(s) 127, 403, 547
AluI AGCT 3 cut(s) 127, 403, 547
AlwI GGATC 1 cut(s) 424
AlwNI CAGNNNCTG 1 cut(s) 103
ApoI RAATTY 1 cut(s) 635
AspS9I GGNCC 1 cut(s) 644
AvaII GGWCC 1 cut(s) 644
BbsI GAAGAC 2 cut(s) 23, 181
BccI CCATC 2 cut(s) 344, 569
BciT130I CCWGG 1 cut(s) 651
BciVI GTATCC 1 cut(s) 536
BfaI CTAG 1 cut(s) 44
BfuI GTATCC 1 cut(s) 536
BglII AGATCT 1 cut(s) 201
BmcAI AGTACT 1 cut(s) 583
Bme1390I CCNGG 1 cut(s) 651
Bme18I GGWCC 1 cut(s) 644
BmgT120I GGNCC 1 cut(s) 644
BmrFI CCNGG 1 cut(s) 651
BmsI GCATC 1 cut(s) 387
BpiI GAAGAC 2 cut(s) 23, 181
BplI GAGNNNNNCTC 2 cut(s) 346, 378
BpuEI CTTGAG 3 cut(s) 260, 365, 419
Bsa29I ATCGAT 1 cut(s) 419
BseBI CCWGG 1 cut(s) 651
BseCI ATCGAT 1 cut(s) 419
BseGI GGATG 5 cut(s) 79, 355, 378, 580, 600
BseMII CTCAG 1 cut(s) 285
BseRI GAGGAG 1 cut(s) 370
BshVI ATCGAT 1 cut(s) 419
BsiSI CCGG 1 cut(s) 27
BsmI GAATGC 2 cut(s) 201, 300
Bsp143I GATC 2 cut(s) 201, 416
BspCNI CTCAG 1 cut(s) 286
BspDI ATCGAT 1 cut(s) 419
BspPI GGATC 1 cut(s) 424
BssMI GATC 2 cut(s) 201, 416
Bst2UI CCWGG 1 cut(s) 651
Bst4CI ACNGT 3 cut(s) 155, 173, 619
BstC8I GCNNGC 2 cut(s) 334, 338
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 5 cut(s) 79, 355, 378, 580, 600
BstKTI GATC 2 cut(s) 204, 419
BstMBI GATC 2 cut(s) 201, 416
BstNI CCWGG 1 cut(s) 651
BstNSI RCATGY 1 cut(s) 428
BstSCI CCNGG 1 cut(s) 649
BstV2I GAAGAC 2 cut(s) 23, 181
BstX2I RGATCY 1 cut(s) 201
BstYI RGATCY 1 cut(s) 201
Bsu15I ATCGAT 1 cut(s) 419
BsuI GTATCC 1 cut(s) 536
BsuTUI ATCGAT 1 cut(s) 419
BtsCI GGATG 5 cut(s) 79, 355, 378, 580, 600
Cac8I GCNNGC 2 cut(s) 334, 338
CaiI CAGNNNCTG 1 cut(s) 103
Cfr13I GGNCC 1 cut(s) 644
ClaI ATCGAT 1 cut(s) 419
Csp6I GTAC 2 cut(s) 174, 582
CviAII CATG 5 cut(s) 109, 139, 425, 459, 632
CviJI RGCY 5 cut(s) 127, 322, 368, 403, 547
CviKI_1 RGCY 5 cut(s) 127, 322, 368, 403, 547
CviQI GTAC 2 cut(s) 174, 582
DdeI CTNAG 1 cut(s) 294
DpnI GATC 2 cut(s) 203, 418
DpnII GATC 2 cut(s) 201, 416
DraIII CACNNNGTG 1 cut(s) 271
DrdI GACNNNNNNGTC 1 cut(s) 651
DseDI GACNNNNNNGTC 1 cut(s) 651
Eco47I GGWCC 1 cut(s) 644
EcoRII CCWGG 1 cut(s) 649
FaeI CATG 5 cut(s) 112, 142, 428, 462, 635
FaiI YATR 9 cut(s) 38, 110, 140, 426, 460, 513, 537, 558, 633
FalI AAGNNNNNCTT 2 cut(s) 536, 568
FatI CATG 5 cut(s) 108, 138, 424, 458, 631
FblI GTMKAC 1 cut(s) 392
FokI GGATG 5 cut(s) 86, 362, 365, 587, 587
FspBI CTAG 1 cut(s) 44
HapII CCGG 1 cut(s) 27
Hin1II CATG 5 cut(s) 112, 142, 428, 462, 635
HindIII AAGCTT 1 cut(s) 545
HinfI GANTC 1 cut(s) 389
HpaII CCGG 1 cut(s) 27
Hpy166II GTNNAC 2 cut(s) 393, 644
Hpy188I TCNGA 2 cut(s) 194, 256
Hpy188III TCNNGA 8 cut(s) 13, 44, 92, 217, 239, 382, 499, 604
Hpy8I GTNNAC 2 cut(s) 393, 644
HpyAV CCTTC 2 cut(s) 78, 268
HpyCH4III ACNGT 3 cut(s) 155, 173, 619
HpyCH4IV ACGT 2 cut(s) 181, 270
HpyCH4V TGCA 2 cut(s) 199, 631
HpyF3I CTNAG 1 cut(s) 294
HpySE526I ACGT 2 cut(s) 181, 270
Hsp92II CATG 5 cut(s) 112, 142, 428, 462, 635
Kzo9I GATC 2 cut(s) 201, 416
LweI GCATC 1 cut(s) 387
MaeI CTAG 1 cut(s) 44
MaeII ACGT 2 cut(s) 181, 270
MalI GATC 2 cut(s) 203, 418
MboI GATC 2 cut(s) 201, 416
MboII GAAGA 4 cut(s) 28, 67, 181, 463
MflI RGATCY 1 cut(s) 201
MluCI AATT 4 cut(s) 261, 486, 566, 635
MlyI GAGTC 1 cut(s) 398
MseI TTAA 2 cut(s) 435, 471
MspI CCGG 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 651
Mva1269I GAATGC 2 cut(s) 201, 300
MvaI CCWGG 1 cut(s) 651
NdeII GATC 2 cut(s) 201, 416
NlaIII CATG 5 cut(s) 112, 142, 428, 462, 635
NspI RCATGY 1 cut(s) 428
PciI ACATGT 1 cut(s) 424
PctI GAATGC 2 cut(s) 201, 300
PflFI GACNNNGTC 1 cut(s) 22
PleI GAGTC 1 cut(s) 397
PpsI GAGTC 1 cut(s) 397
PscI ACATGT 1 cut(s) 424
Psp6I CCWGG 1 cut(s) 649
PspGI CCWGG 1 cut(s) 649
PspPI GGNCC 1 cut(s) 644
PstNI CAGNNNCTG 1 cut(s) 103
PsuI RGATCY 1 cut(s) 201
PsyI GACNNNGTC 1 cut(s) 22
RsaI GTAC 2 cut(s) 175, 583
RsaNI GTAC 2 cut(s) 174, 582
SaqAI TTAA 2 cut(s) 435, 471
Sau3AI GATC 2 cut(s) 201, 416
Sau96I GGNCC 1 cut(s) 644
ScaI AGTACT 1 cut(s) 583
SchI GAGTC 1 cut(s) 398
ScrFI CCNGG 1 cut(s) 651
SetI ASST 9 cut(s) 51, 129, 184, 246, 273, 405, 471, 549, 649
SfaNI GCATC 1 cut(s) 387
SinI GGWCC 1 cut(s) 644
SmlI CTYRAG 3 cut(s) 239, 344, 398
SmoI CTYRAG 3 cut(s) 239, 344, 398
Sse9I AATT 4 cut(s) 261, 486, 566, 635
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 649
TaaI ACNGT 3 cut(s) 155, 173, 619
TaiI ACGT 2 cut(s) 184, 273
TaqI TCGA 3 cut(s) 210, 412, 419
TasI AATT 4 cut(s) 261, 486, 566, 635
TatI WGTACW 2 cut(s) 173, 581
Tru1I TTAA 2 cut(s) 435, 471
Tru9I TTAA 2 cut(s) 435, 471
TspDTI ATGAA 2 cut(s) 545, 648
Tth111I GACNNNGTC 1 cut(s) 22
VpaK11BI GGWCC 1 cut(s) 644
XapI RAATTY 1 cut(s) 635
XbaI TCTAGA 1 cut(s) 43
XceI RCATGY 1 cut(s) 428
XmiI GTMKAC 1 cut(s) 392
XspI CTAG 1 cut(s) 44
ZrmI AGTACT 1 cut(s) 583
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.