Rh1AG281800

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
51127051 .. 51127290
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG281800.1

Sequence Viewer

Length: 240 bp
ATGGAGATTTTCGTGAAGACCCCGTCCGACAAGACCATAACTCTAGAGGTAGAGAAGATTGATACGATAGGGGATGTAAAGGCAACGGTTCAAGACCAGAAACTGCTCATGTTGTTTGATAAACAGCTTGACGATGACATGACTTTGGCAGACTGTAATATCTGGGAGAACTGTACTTTACGTCTGGTCTTCGGAATGCAGATCTTTGTCGAAATCCTGAATGGGAGGACAATCATGTAA

Protein Analysis

79

Amino Acids

9.1

Weight (kDa)

4.34

Isoelectric Point (pI)

27.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 3 - 64 2.3e-10 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021109)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g16171
rosa_chinensis RchiOBHm_Chr1g0359161
rosa_samantha Rh1AG281800 Rh1CG266200 Rh1DG277300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 175
AgsI TTSAA 1 cut(s) 92
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
AlwNI CAGNNNCTG 1 cut(s) 103
BbsI GAAGAC 2 cut(s) 23, 181
BfaI CTAG 1 cut(s) 44
BglII AGATCT 1 cut(s) 201
BpiI GAAGAC 2 cut(s) 23, 181
BseGI GGATG 1 cut(s) 79
BsmI GAATGC 1 cut(s) 201
Bsp143I GATC 1 cut(s) 201
BssMI GATC 1 cut(s) 201
Bst4CI ACNGT 3 cut(s) 88, 155, 173
BstF5I GGATG 1 cut(s) 79
BstKTI GATC 1 cut(s) 204
BstMBI GATC 1 cut(s) 201
BstV2I GAAGAC 2 cut(s) 23, 181
BstX2I RGATCY 1 cut(s) 201
BstYI RGATCY 1 cut(s) 201
BtsCI GGATG 1 cut(s) 79
CaiI CAGNNNCTG 1 cut(s) 103
Csp6I GTAC 1 cut(s) 174
CviAII CATG 3 cut(s) 109, 139, 235
CviJI RGCY 1 cut(s) 127
CviKI_1 RGCY 1 cut(s) 127
CviQI GTAC 1 cut(s) 174
DpnI GATC 1 cut(s) 203
DpnII GATC 1 cut(s) 201
FaeI CATG 3 cut(s) 112, 142, 238
FaiI YATR 4 cut(s) 38, 110, 140, 236
FatI CATG 3 cut(s) 108, 138, 234
FokI GGATG 1 cut(s) 86
FspBI CTAG 1 cut(s) 44
Hin1II CATG 3 cut(s) 112, 142, 238
Hpy188I TCNGA 2 cut(s) 28, 194
Hpy188III TCNNGA 4 cut(s) 13, 44, 92, 217
HpyCH4III ACNGT 3 cut(s) 88, 155, 173
HpyCH4IV ACGT 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 199
HpySE526I ACGT 1 cut(s) 181
Hsp92II CATG 3 cut(s) 112, 142, 238
Kzo9I GATC 1 cut(s) 201
LpnPI CCDG 4 cut(s) 110, 148, 170, 230
MaeI CTAG 1 cut(s) 44
MaeII ACGT 1 cut(s) 181
MalI GATC 1 cut(s) 203
MboI GATC 1 cut(s) 201
MboII GAAGA 3 cut(s) 28, 67, 181
MflI RGATCY 1 cut(s) 201
MmeI TCCRAC 1 cut(s) 51
MnlI CCTC 2 cut(s) 40, 219
Mva1269I GAATGC 1 cut(s) 201
NdeII GATC 1 cut(s) 201
NlaIII CATG 3 cut(s) 112, 142, 238
PctI GAATGC 1 cut(s) 201
PflFI GACNNNGTC 1 cut(s) 22
PstNI CAGNNNCTG 1 cut(s) 103
PsuI RGATCY 1 cut(s) 201
PsyI GACNNNGTC 1 cut(s) 22
RsaI GTAC 1 cut(s) 175
RsaNI GTAC 1 cut(s) 174
Sau3AI GATC 1 cut(s) 201
SetI ASST 3 cut(s) 51, 129, 184
SspMI CTAG 1 cut(s) 44
TaaI ACNGT 3 cut(s) 88, 155, 173
TaiI ACGT 1 cut(s) 184
TaqI TCGA 1 cut(s) 210
TatI WGTACW 1 cut(s) 173
Tth111I GACNNNGTC 1 cut(s) 22
XbaI TCTAGA 1 cut(s) 43
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.